We narrowed to 66,674 results for: %s
-
Plasmid#181696PurposeExpresses SARS-CoV-2 NTD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253,Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-C.37-AVI
Plasmid#181699PurposeExpresses SARS-CoV-2 RBD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-C.37-AVI
Plasmid#181693PurposeExpresses SARS-CoV-2 S2P protein from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253, L452Q, F490S, D61…Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-L452R-AVI
Plasmid#176452PurposeExpresses SARS-CoV-2 RBD-SD1 domain containing L452R mutation with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-S477N-AVI
Plasmid#176453PurposeExpresses SARS-CoV-2 RBD-SD1 domain containing S477N mutation with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-E484K-AVI
Plasmid#176454PurposeExpresses SARS-CoV-2 RBD-SD1 domain containing E484K mutation with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L452R-E484Q-AVI
Plasmid#176445PurposeExpresses SARS-CoV-2 RBD domain containing L452R-E484Q mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L452R-E484Q (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452R, E484QAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L452R-T478K-AVI
Plasmid#176446PurposeExpresses SARS-CoV-2 RBD domain containing L452R-T478K mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L452R-T478K (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452R, T478KAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-WA1-AVI
Plasmid#176448PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the WA1 strain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-G142D-E154K-AVI
Plasmid#176434PurposeExpresses SARS-CoV-2 NTD domain containing G142D-E154K mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-G142D-E154K (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG142D, E154KAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-AY.1-AVI
Plasmid#176437PurposeExpresses SARS-CoV-2 NTD domain from the AY.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-AY.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, T95I, G142D, del156-157, R158G, W258LAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-AY.1-AVI
Plasmid#176335PurposeExpresses SARS-CoV-2 S2P protein from the AY.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-AY.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, T95I, G142D, del156-157, R158G, W258L, K417…Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-T95I-D253G-AVI
Plasmid#176432PurposeExpresses SARS-CoV-2 NTD domain containing T95I-D253G mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-T95I-D253G (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, D253GAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
C514-E13: attB5r-RU5u-His6-GST-nostop-attB1r
Plasmid#162955PurposeGateway attB5r/attB1r entry clone for generation of N-terminal FLAG-tagged fusion proteinsDepositorInsertHis6-Glutathione-S-transferase fusion tag with upstream HTLV RU5 5' UTR
UseSynthetic BiologyAvailable sinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LP102: pMAGIC (R4-R3) NLS-Sp Cas9-NLS
Plasmid#132927PurposepMAGIC R4-R3 entry plasmid, contains 2xNLS SpCas9 (nuclease active) for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInserthumanized SpCas9
UseCRISPR, Gateway Cloning, and Synthetic BiologyAvailable sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUPD2-ATPAMTS (12)
Plasmid#101696PurposeATPAMTS in domestication vectorDepositorInsertCCAT-[MTS from S. cerevisiae ATP synthase subunit alpha (YBL099W)]-AATG
ExpressionYeastAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PDXK_pCSdest
Plasmid#53900DepositorAvailable sinceMarch 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only