We narrowed to 20,258 results for: INO
-
Viral Prep#137150-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP (#137150). In addition to the viral particles, you will also receive purified pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP plasmid DNA. nEF-driven, Flp-dependent expression of Arch3.3-EYFP (inhibited in presence of Cre) for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Flp-dependent)Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP (AAV8)
Viral Prep#137140-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP (#137140). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP plasmid DNA. nEF-driven, Cre-dependent expression of ChR2(E123T/T159C)-EYFP (inhibited in presence of Flp) for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre-dependent)Available SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP (AAV Retrograde)
Viral Prep#137164-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-nEF-Con/Fon/Von eYFP (#137164). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon/Von eYFP plasmid DNA. nEF-driven, Cre, Flp and VCre-dependent expression of EYFP. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre, Flp and VCre-dependent)Available SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRi(v2)-Blast
Plasmid#170068PurposeExpresses dCas9 repressor KRAB-dCas9-MeCP2 and blasticidin resistanceDepositorInsertKRAB-dCas9-MeCP2
UseCRISPR and LentiviralTags2A and 2xHA tagExpressionMammalianPromoterEFS-NSAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT_CMV_NES-Caprola_01-mEGFP
Plasmid#194681PurposeCMV driven expression of the calcium recorder Caprola_01 in mammalian cell lines fused to mEGFPDepositorInsertCaprola_01-mEGFP
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCH45 (multiAsCas12a-KRAB lenti)
Plasmid#217330PurposeLentiviral expression of multiAsCas12a-KRABDepositorInsertmultiAsCas12a
UseCRISPR and LentiviralTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2MutationR1226A/E174R/S542R/K548RPromoterUCOE-SFFVAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_06-mEGFP
Plasmid#194693PurposeCMV driven expression of the calcium recorder Caprola_06 fused to mEGFP for neuronal expression through through lentivirus transductionDepositorInsertCaprola_06-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_off-mEGFP
Plasmid#194695PurposeCMV driven expression of the inactive calcium recorder negative control Caprola_off fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_off-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT_CMV_NES-Caprola_09-mEGFP
Plasmid#194685PurposeCMV driven expression of the calcium recorder Caprola_09 in mammalian cell lines fused to mEGFPDepositorInsertCaprola_09-mEGFP
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_15
Plasmid#194676PurposeProtein production of the split HaloTag based calcium recorder Caprola_15 in bacteriaDepositorInsertCaprola_15
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-P-CAG-GFP
Plasmid#80491Purposedonor vector for AAVS1 targeting (puromycin selection) and constitutive GFP expressionDepositorInsertCAG-GFP
UseDonor vector (human)ExpressionMammalianPromoterCAGAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast
Plasmid#61425Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)DepositorHas ServiceLentiviral PrepInsertdCAS9(D10A, N863A)-VP64_2A_Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET151-Vps4(101-437)-Hcp1
Plasmid#87737PurposeBacterial expression of S. cerevisiae Vps4 AAA ATPase cassette fused to P. aeruginosa Hcp1DepositorInsertVacuolar protein sorting-associated protein 4 (VPS4 Budding Yeast)
Tags6xHis-V5-TEV and Hcp1ExpressionBacterialMutationdeleted amino acids 1-100PromoterT7Available SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-BiFC
Plasmid#87856PurposepETDUET-1 based vector for use in BiMolecular Fluorescence Complementation based assays. MCS at 5' of each BiFC fragment.DepositorInsertsEncodes for MCS & C-term half of mVenus
Encodes for MCS & N-term half of mVenus
TagsBiFC C-terminal fragmentExpressionBacterialPromoterT7Available SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mScarlet
Plasmid#131001PurposeAAV vector to drive the expression of mScarlet under the control of human Synapsin promoterDepositorHas ServiceAAV1 and AAV8InsertmScarlet
UseAAVPromoterhSynAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/mStayGold(c4)=UtrCH
Plasmid#212020PurposeFor filamentous actin labeling. Alternatively, the UtrCH gene can be replaced with a target gene for N-terminal tagging with mStayGold via a c4 adaptor and a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertUtrCH
TagsmStayGold(c4)ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(F74G)
Plasmid#140730PurposeOsTIR1(F74G)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(F74G)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET30a-SSDH
Plasmid#239573PurposeExpresses E. coli succinate semialdehyde dehydrogenase (SSDH/gabD) for recombinant protein purification. Contains a His6-tag on its C-terminus for Ni2+ affinity chromatography.DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/F-tractin=mStayGold
Plasmid#212019PurposeFor filamentous actin labeling. Alternatively, the F-tractin gene can be replaced with a target molecule gene for C-terminal tagging with mStayGold through a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertF-tractin
TagsmStayGoldExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only