We narrowed to 2,589 results for: GCG
-
Plasmid#227494Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 44kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-700bp-USP
Plasmid#227452Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 700bp Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-PrPro
Plasmid#227454Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-55kb-USF
Plasmid#227458Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 55kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-11kb-USP
Plasmid#227447Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPOLR2D
Plasmid#229022PurposeExpression of a CRISPRi doxycycline inducible guide targeting POLR2DDepositorInsertPOLR2D gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgGFP
Plasmid#213165PurposeVector with sgGFP for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6 and PGKAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pGL3-NCL-gRNA2-EGFP
Plasmid#226005PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA285
Plasmid#215947PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD81_v1; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA023
Plasmid#215931PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD81_v1 [Sp]; trRNA_v2 [Sp]; CS2
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK2_sgRNA2
Plasmid#201633PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK2 (UCK2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.2
Plasmid#201404PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-1
Plasmid#124474PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-1_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgPLXNB2
Plasmid#86151PurposeCas9/CRISPR plasmid for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPRAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only