We narrowed to 6,041 results for: SUP
-
Plasmid#180332Purposemammalian expression of human SEPT9_i1-i5 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v7 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1-i5PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2
Plasmid#169216PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available SinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail
Plasmid#60392PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) using a GAL promoterDepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circSMAD2_2
Plasmid#215222PurposeSupression of shcircSMAD2(2,7)_2 expressionDepositorInsertcircSMAD2 shRNA 2 (SMAD2 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S111F-msfGFP
Plasmid#180340Purposemammalian expression of human SEPT9_i1 S111F fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 S111FPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R106W-msfGFP
Plasmid#180339Purposemammalian expression of human SEPT9_i1 R106W fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R106WPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 D10-25-msfGFP
Plasmid#180334Purposemammalian expression of human SEPT9_i1 D10-25 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 D10-25PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 DN7-msfGFP
Plasmid#180335Purposemammalian expression of human SEPT9_i1 DN7 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 DN7PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 NCmut2-msfGFP
Plasmid#180330Purposemammalian expression of human SEPT9_i1 NCmut2 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b p97-Strep-His E314Amb
Plasmid#169021PurposeExpresses p97-Strep-His E314Amb (incorporates noncanonical amino acid at position 314 via amber suppression) in bacteriaDepositorInsertp97
TagsHis and SBPExpressionBacterialMutationE314TAGPromoterT7Available SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO R106L-CPTP
Plasmid#170737PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO K60A-CPTP
Plasmid#170736PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMA-KO, S199AzF)-HIS
Plasmid#153444PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode A knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R10A R15A-msfGFP
Plasmid#180336Purposemammalian expression of human SEPT9_i1 R10A R15A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R10A R15APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)
Plasmid#182287PurposeEncodes codon-optimized AF mutant of M. mazei-derived pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & tRNACUAPyl used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKI_ΩBBMVP16&SRDXWUSm1
Plasmid#220349PurposeExpresses BBM-VP16 and SRDX-WUSm1 in plant cellsDepositorTagsSuperman Repression Domain X (SRDX) and VP16 tran…ExpressionPlantMutationtwo amino acid substitution in WUS-box: L255A L25…PromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only