We narrowed to 11,308 results for: ENA
-
Plasmid#189785PurposeGolden Gate entry vector to clone the 4th Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ131-RZ-Cas12j2
Plasmid#173927PurposeGolden Gate entry vector; empty vector to clone the 1st Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-RZ-Cas12j2
Plasmid#173928PurposeGolden Gate entry vector; empty vector to clone the 2nd Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-RZ-Cas12j2
Plasmid#173929PurposeGolden Gate entry vector; empty vector to clone the 3rd Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-RZ-Cas12j2
Plasmid#173930PurposeGolden Gate entry vector; empty vector to clone the 4th Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::PpsbA2*::B0032::CYP110D1
Plasmid#186707PurposeCYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1
Plasmid#186709PurposeCYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOD_004
Plasmid#155361PurposeGentamycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOD_003
Plasmid#155362PurposeZeomycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only