We narrowed to 10,223 results for: Uty
-
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P4-P1R:PER36modp
Plasmid#128431PurposeGateway (Invitrogen) promoter clone (pDONR_P4-P1R) with premature stop codons introduced within the Xero1 and Xero2 genes in the PER36 promoter entry clone (Kunieda et al. 2013).DepositorInsertPEROXISADE36 (AT3G50990 Mustard Weed)
UseGateway promoter entry cloneMutationPremature stop codons introduced into the Xero1 (…PromoterPEROXISADE36Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(Apc-g1)-PGKpuroBFP-W
Plasmid#105022PurposeLentiviral gRNA plasmid targeting mouse Apc , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Progerin-S22D-CS-pLPC
Plasmid#73810PurposeProgerin mutant where Serine 22 is mutated to aspartic acid and where there is a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with substitution of cysteine in CaaX-mo…PromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only