We narrowed to 11,287 results for: aga
-
Plasmid#65369PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only
-
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Cas9-T2A-TdT
Plasmid#126424PurposeExpresses Cas9-T2A-TdT in mammalian cells. (pTBL209)DepositorAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-mTurquoise2-IL-1beta-mNeonGreen
Plasmid#166783PurposeFRET analysis (pro-IL-1beta cleavage) in living cellsDepositorInsertmTurquoise2-IL-1b-mNeongreen (IL1B Human)
UseLentiviralTagsmNeonGreen and mTurquoise2ExpressionMammalianPromoterCMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-HLA-A0201-His
Plasmid#108213PurposeHLA-A0201 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-A Human)
UseEntry vector for gateway systemTagshisAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-hDDX5/17
Plasmid#71307PurposeInducible shRNA knockdown of both human DDX5 and DDX17 genesDepositorAvailable SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-mTurquoise2-Caspase-1-mNeonGreen
Plasmid#166784PurposeFRET analysis (pro caspase-1 cleavage) in living cellsDepositorInsertmTurquoise2-caspase-1-mNeonGreen (CASP1 Human)
UseLentiviralTagsmNeonGreen and mTurquoise2ExpressionMammalianPromoterCMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-Twin-Strep
Plasmid#202528PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-rsChRmine-oScarlet-WPRE
Plasmid#183528PurposeOptogeneticsDepositorInsertrsChRmine-oScarlet
UseAAVMutationI146M/G174SPromoterEf1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-ChRmine-oScarlet-WPRE
Plasmid#183524PurposeOptogeneticsDepositorInsertChRmine-oScarlet
UseAAVPromoterEf1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ2A
Plasmid#65373PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-KLC1
Plasmid#166964PurposeExpresses Myc-tagged KLC1 protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMega-MaPylRS
Plasmid#200225PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with Nε-Boc-lysine.DepositorInsertsPyrrolysyl-tRNA synthetase
pyrrolysyl-tRNA
TagsnoneExpressionBacterialMutationnonePromoterproK-lacO and tacIAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-NoMi-P2A-CopGFP-T2A-PuroR
Plasmid#207805PurposeE-NoMi is a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins under an EF-1α promoter.DepositorInsertE-NoMi
UseLentiviralTags3xFlag tag, copGFP, mCherry, and nanoluciferaseExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAED2
Plasmid#234599PurposeFluorescent reporter of the SOS responseDepositorInsertsmScarlet-I
gfp-mut2
UseReporterExpressionBacterialMutationGFPmut2 was derived from avGFP with the following…PromoterPtet+dnaK P1 and cdaAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only