We narrowed to 12,153 results for: CHL
-
Plasmid#222209PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G258D mutation and a C-terminal His tagDepositorInsertfghA (G258D)
Tags6x HisExpressionBacterialMutationChanged Gly258 to AspartatePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB111
Plasmid#222210PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G76V mutation and a C-terminal His tagDepositorInsertfghA(G76V)
Tags6x HisExpressionBacterialMutationChanged glycine 76 to valinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB112
Plasmid#222211PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the S11R mutation and a C-terminal His tagDepositorInsertfghA(S11R)
Tags6x HisExpressionBacterialMutationChanged Serine 11 to ArgininePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB113
Plasmid#222212PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the W15C mutation and a C-terminal His tagDepositorInsertfghA(W15C)
Tags6x HisExpressionBacterialMutationChanged Tryptophan 15 to CysteinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
Plasmid#217514PurposeEncodes a UAS controlled and Flp dependent conditional trangene of bicistronic myrTdtomato and KD RecombinaseDepositorInsert10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
ExpressionInsectAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
p931-SWITCH-OVER insert: EF1a-Blasti
Plasmid#217890Purposeinsert vector for Switch-OVER: Single loxP-STOP-EF1a-Blasti-mU6DepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only