We narrowed to 7,956 results for: Lif
-
Plasmid#140148PurposeGAL4-DNA binding domain fusion protein with amino acids 159 to 329 of human KLF4 (repressor domain)DepositorInsertKLF4 aa 159-329 (KLF4 Human)
TagsGAL4dbdExpressionMammalianMutationDeleted amino acids 1 to 158 and 330 to 479PromoterEF1aAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4 + PGK-puro
Plasmid#167824PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-puro
Plasmid#167830PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4(TA) + PGK-puro
Plasmid#167826PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4 + PGK-blast
Plasmid#167825PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-PGC-1alpha-IRES-mCitrine
Plasmid#241791PurposeExpression vector for mouse Pgc-1alpha with mCitrineDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Tre-Rac1-P29S (FLARE)
Plasmid#241371PurposeDox-inducible expression of Rac1-P29S FLARE sensorDepositorUseLentiviralTagsYPet (N terminal to Pak1) and mCerulean3 (N termi…MutationP29S in Rac1PromoterTREAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET19b-pps-UvsX
Plasmid#236046PurposepET19b-pps-UvsXDepositorInsertUvsX
TagsHis tagExpressionBacterialPromoterT7 RNA polymeraseAvailable SinceAug. 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET19b-pps-gp32
Plasmid#236044Purposegp32, synthetic geneDepositorInsertgp32
TagsHis tagExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET19b-pps-UvsY
Plasmid#236045PurposepET19b-pps-UvsYDepositorInsertUvsY
TagsHis tagExpressionBacterialPromoterT7 RNA polymeraseAvailable SinceJuly 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-FLEX-CAG_G-PTEN
Plasmid#227438PurposeAn AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.DepositorInsertG-PTEN sensor (Pten Rat)
UseAAVTagsCD-sREACh and mEGFPExpressionMammalianMutationR14GPromoterpCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-NIL
Plasmid#233154PurposeRetroviral expression of Ngn2, Isl1, and Lhx3 for motor neuron reprogrammingDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53 QM
Plasmid#196268PurposeMammalian expression of 3xHA tagged p53 L25Q,Q26S,F53Q,F54SDepositorInsertTrp53 QM (Trp53 Mouse)
Tags3xHAExpressionMammalianMutationp53 L25Q,Q26S,F53Q,F54S mutantPromoterCMVAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-blast
Plasmid#167831PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X Y381H
Plasmid#225723PurposeTransfection of USP27X (Y381H) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only