We narrowed to 32,698 results for: LIS;
-
Viral Prep#162381-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE (#162381). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (AAV1)
Viral Prep#162382-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (#162382). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of the ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (AAV9)
Viral Prep#162382-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (#162382). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of the ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV CD68-hM4D(Gi)-mCherry (AAV9)
Viral Prep#75033-AAV9PurposeReady-to-use AAV9 particles produced from pAAV CD68-hM4D(Gi)-mCherry (#75033). In addition to the viral particles, you will also receive purified pAAV CD68-hM4D(Gi)-mCherry plasmid DNA. CD68-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced microglial inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCD68TagsmCherryAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pmSyn1-EBFP-Cre (AAV5)
Viral Prep#51507-AAV5PurposeReady-to-use AAV5 particles produced from AAV pmSyn1-EBFP-Cre (#51507). In addition to the viral particles, you will also receive purified AAV pmSyn1-EBFP-Cre plasmid DNA. EBFP-Cre expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterpmSyn1TagsEBFPAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV Retrograde)
Viral Prep#162376-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus (AAV9)
Viral Prep#139504-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-DIO-PPO-Venus (#139504). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-PPO-Venus plasmid DNA. CAG-driven, Cre-dependent expression of Venus-tagged parapinopsin. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsVenusAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CD68-hM4D(Gi)-mCherry (AAV1)
Viral Prep#75033-AAV1PurposeReady-to-use AAV1 particles produced from pAAV CD68-hM4D(Gi)-mCherry (#75033). In addition to the viral particles, you will also receive purified pAAV CD68-hM4D(Gi)-mCherry plasmid DNA. CD68-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced microglial inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCD68TagsmCherryAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (AAV5)
Viral Prep#162382-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (#162382). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of the ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus (AAV5)
Viral Prep#139504-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-DIO-PPO-Venus (#139504). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-PPO-Venus plasmid DNA. CAG-driven, Cre-dependent expression of Venus-tagged parapinopsin. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsVenusAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTL
Plasmid#203176PurposeCentromeric yeast expression vector, leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-DHDDS
Plasmid#203177PurposeCentromeric yeast expression vector for hDHDDSDepositorAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1199
Plasmid#29100PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorAvailable SinceNov. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1200
Plasmid#29101PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorAvailable SinceNov. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1524
Plasmid#29255PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle53 (DCX Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 3, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1198
Plasmid#29099PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-