We narrowed to 25,094 results for: EMB
-
Plasmid#191242PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A31 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-CP8B1
Plasmid#191240PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-CP8B1 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), CYP8B1 (CYP12) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGB_ctail_mKate2_CLEAVAGE
Plasmid#167338PurposeExpresses mKate2 fused to TFAM HMGB+C-tail mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8f (AAV9)
Viral Prep#176759-AAV9PurposeReady-to-use AAV9 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8f (#176759). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8f plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8s (AAV9)
Viral Prep#176761-AAV9PurposeReady-to-use AAV9 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8s (#176761). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8s plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8m (AAV1)
Viral Prep#176760-AAV1PurposeReady-to-use AAV1 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8m (#176760). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8m plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8m (AAV5)
Viral Prep#176760-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8m (#176760). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8m plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8m (AAV9)
Viral Prep#176760-AAV9PurposeReady-to-use AAV9 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8m (#176760). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8m plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8s (AAV1)
Viral Prep#176761-AAV1PurposeReady-to-use AAV1 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8s (#176761). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8s plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.n into animals.DepositorPromoterGfaABC1DAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8f (AAV1)
Viral Prep#176759-AAV1PurposeReady-to-use AAV1 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8f (#176759). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8f plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pStA1BZ
Plasmid#114164PurposeStart-Stop Assembly Level 1BZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1BC
Plasmid#114165PurposeStart-Stop Assembly Level 1BC plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1CZ
Plasmid#114166PurposeStart-Stop Assembly Level 1CZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA212
Plasmid#114171PurposeStart-Stop Assembly Level 212 plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pStA1DZ
Plasmid#114168PurposeStart-Stop Assembly Level 1DZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only