We narrowed to 1,306 results for: grna cloning vector
-
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-KRAB-GFP backbone
Plasmid#194281PurposeVector for CRISPRi-GFP expression ready for gateway cloning of sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR1068
Plasmid#111092PurposeBFP/puromycin marked gRNA vector. Contains sgRNA against GFP/BFP N-terminus.DepositorTypeEmpty backboneUseLentiviralMutationBlpI site disruptedAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-LacZ-GFP-Puro (BB)
Plasmid#170459PurposeFor cloning gRNA blockDepositorInserthU6-BB-LacZ and EF1A-EGFP-2A-Puro
UseLentiviralExpressionMammalianPromoterhU6 for gRNA and EF1A for EGFP-2A-PuroAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTAJAK-71 (pESC-NatMXsyn-USER)
Plasmid#78232PurposeEmpty vector, for the insertion of gRNA expression cassettes into the vector.DepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRI012-pGEM-PacI-PU3-BsmbI-NotI
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…PromoterAspergillus fumigatus U3 (RNAPIII).Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT077
Plasmid#137879PurposeDonor vector for integration into the human AAVS1 safe harbor locus of Doxicycline-inducible KRAB-dCas9-IRES-EGFPDepositorInsertTRE3G-KRAB-dCas9-IRES-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT076
Plasmid#137880PurposeDonor vector for integration at the human AAVS1 safe harbor locus of Doxicycline-inducible dCas9-VPR-T2A-EGFPDepositorInsertTRE3G-dCas9-VPR-T2A-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGC31
Plasmid#19678DepositorInsertGateway(R1-R2)-L4440
UseRNAi; Gateway destination vectorAvailable SinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGMV-U
Plasmid#112797PurposeUniversal BeYDV-derived vector for cloning of up to four gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGC49
Plasmid#19680DepositorInsertGateway(R1-R2)-L4440
UseRNAi; Gateway destination vectorAvailable SinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC48
Plasmid#19679DepositorInsertGateway(R2-R1)-L4440
UseRNAi; Gateway destination vectorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEF1aAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only