We narrowed to 9,843 results for: CAG
-
Plasmid#177259PurposeA knockout vector for the dog Adam17DepositorInsertA gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA2
Plasmid#166908PurposeLentivirus for inducible knockdown of human AHRDepositorInsertAHR shRNA
UseLentiviralExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCYFIP1-2
Plasmid#210138Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN12RRFuzzy3MYB
Plasmid#194441PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout: CEN12, RR, and Fuzzy3MYBDepositorInsertgRNA array targeting CEN1, RR, Fuzzy3MYB
UseCRISPRExpressionPlantPromoterMtU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
LEPG_shSik3.308
Plasmid#125878PurposeRetroviral expression of mouse Sik3 shRNA with GFP and puromycin resistance geneDepositorInsertshRNA targeting Sik3
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTp130-Reporter-NT
Plasmid#256440PurposeMammalian expression of a TSM with half of GFP-2A-BFP with non-targeting spacerDepositorInsertTrans-splicing module with half of GFP-2A-BFP with non-targeting spacer
ExpressionMammalianPromoterSFFVAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgHcn1#2/Cre
Plasmid#193218PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Hcn1 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-2
Plasmid#246018PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pSpCas9 (BB)-2A-GFP gamma-tubulin sg
Plasmid#104437PurposeKnockdown the expression of gamma-tubulin in human cellsDepositorInsertgamma-tubulin sgRNA
TagsThe gamma-tubulin sgRNA is coexpressed with 3xFLA…ExpressionMammalianAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only