We narrowed to 10,510 results for: CAG
-
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-36kb-USF
Plasmid#227461Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-33kb-USF
Plasmid#227465Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 33kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-20kb-USP
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circRERE_3
Plasmid#215227PurposeSupression of shcircRERE(4-10)_2 expressionDepositorInsertcircRERE shRNA 3 (RERE Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-2
Plasmid#230082PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-AntiHer2-HC121-TAG
Plasmid#226836PurposeContains trastuzumab with a TAG codon at position 121 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 121 of heavy chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBACH1-array_EF1a-BFP
Plasmid#224787PurposeBACH1 targeting crRNA array for RfxCas13d expressed from multiple hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrBACH1-1, crBACH1-2, crBACH1-3,
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -