We narrowed to 6,266 results for: 338
-
Plasmid#174176PurposeLentiviral vector to constitutively express TAZ/WWTR1 under control of the human PGK promoter.DepositorAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits
-
EFSp-GFP-YAP
Plasmid#174168PurposeLentiviral vector to constitutively express YAP under control of the EFS promoter.DepositorAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
P532_POU4F2-p2A-tdTomato-p2A-Thy1.2
Plasmid#239102PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of POU4F2 (aka BRN3B). This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertPOU4F2 (POU4F2 Human)
UseDonor plasmid for integration into the human geno…Tagsp2A-tdTomato-p2A-Thy1.2ExpressionMammalianPromoterEndogenous POU4F2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-YAP (S94A)
Plasmid#174173PurposeLentiviral vector to constitutively express TEAD-binding mutant YAP under control of the human PGK promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationSerine 94 mutated to AlaninePromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-T7-ABE8.20m-SpCas9-NRCH-P2A-EGFP (RMD55)
Plasmid#197501PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRCH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRCH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
P530_SIX6-p2A-h2b-EGFP
Plasmid#239101PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of SIX6. This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertSIX6 (SIX6 Human)
UseDonor plasmidTagsp2A-h2b-EGFPExpressionMammalianPromoterEndogenous SIX6 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-mgp100-PuroR [M1G]
Plasmid#171802PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-PuroR [M1G]
Plasmid#171803PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-BlastR [M1G]
Plasmid#171817PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-gB-BlastR [M1G]
Plasmid#171816PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and blasticidin resistance cassette [p.DepositorInsertmScarlet-F-gB-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-hgp100-BlastR [M1G]
Plasmid#171815PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-gB-PuroR [M1G]
Plasmid#171812PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1DepositorInsertmScarlet-F-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-mgp100-PuroR [M1G]
Plasmid#171811PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-BlastR [M1G]
Plasmid#171808PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-BlastR [M1G]
Plasmid#171807PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-gB-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-BlastR [M1G]
Plasmid#171806PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-PuroR [M1G]
Plasmid#171804PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-YAP (5SA)
Plasmid#174174PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the human PGK promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits