We narrowed to 69 results for: 338
-
TypeBlog Post...Methods in Molecular Biology. Humana Press, pp 331–338 https://doi.org/10.1007/978-1-59745-181-9_23 Additional...
-
GPCRs: How Do They Work and How Do We Study Them?
TypeBlog Post...Peroxidase-Catalyzed Proximity Labeling. Cell 169:338-349.e11 . https://doi.org/10.1016/j.cell.2017.03.028... -
Which Fluorescent Protein Should I Use?
TypeBlog Post...cellular processes” Curr. Protein. Pept. Sci. 9(4):338. Chudakov et. al. (2010) “Fluorescent proteins and... -
Adeno-associated Viruses (AAVs) for Genome Editing
TypeBlog Post...pluripotent stem cells." Molecular Therapy20.2 (2012): 329-338. PubMed PMID: 22108859. PubMed Central PMCID: PMC3277219... -
When Fidelity Matters: A frank discussion about ligase fidelity
TypeBlog Post...Biochem. 77 (2008): 313-338. PubMed PMID: 18518823. PubMed Central PMCID: PMC2933818. 4. Shuman, Stewart....Electrophoresis 34.9-10 (2013): 1415-1422. PubMed PMID: 23463388. 18. Hommatsu, Manami, et al. "Development of ... -
Optogenetics Guide
TypeGuide... distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User’s Guide to... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post... Klapoetke et al., Nat Methods 2014 Mar 11;(3):338-46. For more information and descriptions of various... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...tfe3a TAL3380 & TAL3381 TAAAATAGCCAGTCAGAcactggcaacgtcgacCCCACCACAGCCCTCA tfe3b TAL3382 & TAL3383 TCGCTCAGCTCCGCCCTgcagacaccactcctgccATCTCCGTCTCGCTGCCA...TTCCACGAAACGGTACTTtggagaagctcgcgtcCCTGCAGACCCCAGCGGA tnfb TAL3384 & TAL3385 TGTCGGGGGAGTTTATCAgacaaccgtggcacctGTACCGGTTAATTCTTCA...TGAGGGTTCGGGTGAAATatcgctgggagaggttGAGATGGCATTTCGTAAA TRABD2A TAL3386 & TAL3387 TCAGCTGGAGCGCTTTTCtgcagatctgctggatACTCATGGTGAGAGCAAA...TCCTATGAGTGGTACATTcctaaagggattctgaAGACGGGCTGGATGAACA TTC19 TAL3388 & TAL3389 TGCCAGGAGGAGCAGGGAgagtcccatccgcagacGCTGGTCCTGATGAGTGA...TGACAAGCCTTTCGCCAAggccggcccaagccctTTATCTCGGGTTTTGAGA pink1 TAL3338 & TAL3339 TTTCCTCTCATAGTCAATattaattctctatttgGCTCAAAATGTCAGTAAA... -
Neurodegeneration Plasmid Collection
TypeCollection...Stefan Stamm 203382 Tau BA 12->10 L284R MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203383 Tau BA 12->10...Stefan Stamm 203384 Tau BA 12->10 P301L MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203385 Tau BA 12->10...Stefan Stamm 203386 Tau BA 12->10 G303V MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203387 Tau BA 12->10...Michael J Fox Foundation MJFF 40556 pEMB44 / Zebrafish_LRRK2_1_338 LRRK2 His polH Parkinson's Michael J Fox...PRKN Flag, FOKI CMV Parkinson's Keith Joung 42801 TAL3338 PINK1 Flag, FOKI CMV Parkinson's Keith Joung 42802...BFP-P2A-TDP43 G309F] TARDBP CMV ALS Rajat Rohatgi 107852 pHBS1338 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G348V] TARDBP...S305N MAPT Flag CMV Parkinson's, FTD Stefan Stamm 203388 Tau BA 12->10 S305I MAPT Flag CMV Parkinson's, ... -
CRISPR Guide
TypeCollection...technologies. Nature Methods , 17 (5), 471–479. PMID: 32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann...human cells. PNAS . 112 (10), 3002–3007. PMID: 25713381 Ma, H., Tu, L., Naseri, A., Huisman, M., Zhang... editing. Cell . 184 (9), 2503-2519.e17. PMID: 33838111 Peters, J. M., Koo, B., Patino, R., Heussler, ... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection...NIH. Neuron . 2021 Apr 7;109(7):1080-1083. PMID: 33831364 (Link opens in a new window)... -
Predicting Adverse Reactions to Monoclonal Antibody Drugs
TypeBlog Post...Immunology, 13. https://www.frontiersin.org/articles/10.3389/fimmu.2022.885672Piché, M.-S., Mounho-Zamora, B... in drug discovery, 2, 952326. https://doi.org/10.3389/fddsv.2022.952326Joubert, M. K., Deshpande, M.,... -
Antibodies 101: Producing Recombinant Antibodies
TypeBlog Post...antibodies. Front Immunol. 2013 Jul 29;4:217. doi: 10.3389/fimmu.2013.00217. PMID: 23908655; PMCID: PMC3725456...doi: 10.1002/bit.27776. Epub 2021 May 4. PMID: 33811659. Pace CN, Vajdos F, Fee L, Grimsley G, Gray T.... -
Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus
TypeBlog Post...Targeting. Front Neurosci 11: . https://doi.org/10.3389/fnins.2017.00503 Chamberlain K, Riyad JM, Weber...295:2258–2261 . https://doi.org/10.1126/science.1067338 Ghosh A, Yue Y, Lai Y, Duan D (2008) A Hybrid Vector... -
Viral Vectors 101: AAV Variables That Matter
TypeBlog Post... in Molecular Neuroscience, 7. https://doi.org/10.3389/fnmol.2014.00076 References and Resources References... in Molecular Neuroscience, 7. https://doi.org/10.3389/fnmol.2014.00076 Nieuwenhuis, B., Haenzi, B., Hilton... -
A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression
TypeBlog Post...Concentrations. Front Synaptic Neurosci 12. https://doi.org/10.3389/fnsyn.2020.00006 O’Carroll SJ, Cook WH, Young D...Therapy. Front Mol Neurosci 13. https://doi.org/10.3389/fnmol.2020.618020 Additional resources on the Addgene... -
Antibodies 101: Introduction to Antibodies
TypeBlog Post...Future Outlook. Front Immunol 8: . https://doi.org/10.3389/fimmu.2017.01589 Ayyar BV, Arora S, Ravi SS (2017...Front Cell Infect Microbiol 3: . https://doi.org/10.3389/fcimb.2013.00072 Additional resources on the Addgene... -
CRISPR History and Development for Genome Engineering
TypeCollection...Proc Natl Acad Sci U S A . 112(10):3002-7. PMID: 25713381 Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald... -
Validated gRNA Sequences
TypeCollection...sv40 promoter synthetic CATACTTCTGCCTGCTGGGGAGCCTG 62338 activate/interfere S. pyogenes 25533786 Qi SV40.... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380 MuLE vectors for customized lentivirus production...Friedman, et al. Mol Biol Cell. 2013. PubMed PMID: 23389631 Rowland, et al. Cell. 2014. PubMed PMID: 25416943...