We narrowed to 7,046 results for: lentiviral plasmid
-
Plasmid#205207PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG18DepositorInsertsynCAM iCAM1 and Lag18 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag42-iCAM-1
Plasmid#205205PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG42DepositorInsertsynCAM iCAM1 and Lag42 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MAP2-CD4
Plasmid#43916DepositorAvailable SinceApril 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
1000.pCCLsin.cPPT.hPGK.Brn2.MIRT124_x4 Xma_lost.WPRE
Plasmid#67295PurposeInduce human iN conversion from fibroblastDepositorAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
1000.pCCLsin.cPPT.hPGK.Myt1L.WPRE
Plasmid#67292PurposeInduce human iN conversion from fibroblastDepositorAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
1000.pCCLsin.cPPT.hPGK.Myt1L.MIRT124_x4 Xma_lost.WPRE
Plasmid#67293PurposeInduce human iN conversion from fibroblastDepositorAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPKm-145
Plasmid#90505PurposeEmpty plasmid, pSIN-EF1-alpha-IRES-puroDepositorTypeEmpty backboneUseLentiviralAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCVL TAL(Nd154C63) SFFV Age-Xho/Xba-Sal linkers
Plasmid#50421PurposepTAL plasmid for cloning of megaTALs or other TAL-fusions and expression in mammalian cells. RVDs are cloned between Age-Xho sites and meganuclease/fusion is cloned between Xba-Sal sites.DepositorTypeEmpty backboneUseLentiviral and TALENExpressionMammalianPromoterSFFVAvailable SinceMay 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCVL TAL(Nd154C63) SFFV Xba-Sal linker
Plasmid#50420PurposepTAL plasmid compatible with the Golden Gate TALEN cloning system. For cloning of megaTALs or other TAL-fusions and expression in mammalian cells. Meganuclease/fusion is cloned between Xba-Sal sites.DepositorTypeEmpty backboneUseLentiviral and TALENExpressionMammalianPromoterSFFVAvailable SinceMay 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.GFP.miR-16-2-3p.sensor.PGK.dNGFR.WPRE
Plasmid#85876PurposeSensor PlasmidDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBEd SpG UGI Puro
Plasmid#235045PurposeCytosine base editor d with SpG nicking Cas9 makes C > T editsDepositorInsertCBEd, nCas9
UseCRISPR and LentiviralTagsP2A-PuroRPromoterEF1a coreAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
Plasmid#236731PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selectionDepositorInsertTIMM23 (TIMM23 Human)
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_ER-dAPEX-BFP2
Plasmid#236733PurposeDual sgRNA targeting CTRL expressing dAPEX-BFP targeting to ERDepositorInsertNegative CTRL
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-mCherry
Plasmid#216174PurposeGenerate lentiviruses to act as a positive transduction control for pHAGE2-TetO vectors in pluripotency reprogrammingDepositorInsertmCherry
UseLentiviralAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS-CMV-mP-luc
Plasmid#213506PurposePositive control vector for luciferase lentivirus-based enhancer assayDepositorInsertLuciferase
UseLentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-WT-sgNT
Plasmid#222120PurposeEIF3D overexpression vector with non-targeting sgRNADepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only