We narrowed to 18,120 results for: multi
-
Plasmid#108413PurposeAlpha-tubulin fused to monomeric near-infrared fluorescent protein miRFPDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
Orange Nano-lantern(Ca2+)/pcDNA3
Plasmid#71346PurposeExpress Orange Nano-lantern-based luminescent Ca2+ indicator in mammalian cellDepositorInsertOrange Nano-lantern(Ca2+)
ExpressionMammalianAvailable SinceDec. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSR02
Plasmid#69149PurposeRead-out loxP mCherry to GFP switch for integration on CxTi10816, Mos chr IVDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCLC-mEos2
Plasmid#38010DepositorInsertClathrin, light polypeptide (LCa) (Clta Mouse)
TagsmEos2ExpressionBacterial and MammalianPromoterCMVAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMVp-ECFP-Triplex-28-8xmiRNA-BS-28-pA (Construct 22)
Plasmid#55199PurposeCFP reporter along with FF4 miRNA binding sites and 28 nt sequencesDepositorInsertECFP
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Lck-mCherry-ibARK (AAV5)
Viral Prep#241241-AAV5PurposeReady-to-use AAV5 particles produced from GfaABC1D-Lck-mCherry-ibARK (#241241). In addition to the viral particles, you will also receive purified GfaABC1D-Lck-mCherry-ibARK plasmid DNA. GfaABC1D-driven expression of Lck-mCherry-ibARK. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NESPylRS(AF)_hU6tRNAPyl
Plasmid#223508PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsExpressionMammalianMutationY306A; Y384FPromoterCVM, SP6 and U6Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-GFP
Plasmid#183934PurposePCP tandem dimer binding to PP7 RNA stem loops; labeled with GFPDepositorInserttdPCP-GFP
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBT-PE2-PGK-Blast
Plasmid#173219PurposepiggyBac transposon containing PE2 and Blasticidin expression cassettesDepositorInsertsPE2
Blast
UsePiggybacExpressionMammalianPromoterCMV and hPGKAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ePB-Bsd-CAG-LoxP-dsRed_PA-LoxP-SV40-NLS-NG-T2A-MCS:
Plasmid#179585PurposeePiggyBac vector that has a blasticidin selectable cassette and a LoxP exchangeable dual colors cassette (Red module-dsRed/Green module-NeonGreen)DepositorInsertNLS-NG-T2A-hSHH
UsePiggybacTagsNLS-NG-T2APromoterCAGpAvailable SinceFeb. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-Gaolf-Integration
Plasmid#129456PurposepiggyBac transposon vector that Inducibly (Tet-On) expresses GaolfDepositorAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hMyoD-IRES-dsRed
Plasmid#66631PurposeCo-expresses human MyoD and dsRedDepositorAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCOTS-pyl
Plasmid#92048PurposeThis is a S. elongatus (PCC7942) shuttle vector used for recombination of the pylRS orthogonal translation system to genomic neutral site 2.DepositorInsertsPyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseCyanobacteria s. elongatus genome recombination i…PromoterLeuP (native S. elongatus promoter) and PrcbLAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSPORT1[NheI/glGFP/bglobin3'-UTR/Ins2]
Plasmid#74101Purposevector bearing an NheI restriction site for the two-step cloning method in Wang and Szaro, Dev Biol, 2015DepositorInsertsGreen Lantern Green Fluorescent Protein
Rabbit beta 1-globin gene 3'UTR
Available SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cenp-B DBD INCENP GFP
Plasmid#45237PurposeTarget INCENP to centromeres via CENP-B DNA binding domain (DBD)DepositorInsertCenp-B-DBD, INCENP-Δcen, GFP
TagsDNA binding domain of CENP-B and GFPExpressionMammalianMutationCEN box deleted from INCENP (aa1-46)Available SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-NLS-ZapCmR2
Plasmid#59012PurposeNuclear zinc-binding FRET biosensorDepositorInsertNLS-ZapCmR2 genetically encoded Zn(II) sensor
TagsSV40 NLSExpressionMammalianMutationSee commentPromoterCMVAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-TM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
Plasmid#171615PurposeSoma-targeted Cal-Light with KA2DepositorInsertTM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseSynthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only