We narrowed to 13,908 results for: IGH@
-
Plasmid#75298PurposeExpresses Sacsin Ubl-sr1 (SIRPT1 repeat) domain (1-339) in fusion with GST (bacterial)DepositorInsertHuman Sacsin 1-339
TagsGST-TagExpressionBacterialAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pICOZ-SB100X[EF1α-CD19 4-1BB-eGFP]
Plasmid#218343PurposeDonor plasmid of SB100X Transposon with CD19 CAR mammalian expression cassetteDepositorInsertCD19 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-C2C1-ErNaR-TS-EYFP-ES
Plasmid#209851PurposeExpression of human codon-optimized light-driven sodium pump ErNaR in mammalian cellsDepositorInsertlight-driven sodium pump ErNaR
TagsEYFPExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NES-tdTomato-LINuS-WPRE
Plasmid#159894PurposeAAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signalDepositorInsertNES-tdTomato-LINuS
UseAAVExpressionMammalianPromoterEF1α promoterAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-dTM-HA
Plasmid#139846PurposeLentiviral expression of human DDRGK1-dTM-HADepositorAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K267R-HA
Plasmid#139848PurposeLentiviral expression of human DDRGK1-K267R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBW2702_pCAG-PV1-pMag-L1-iCre-271C-BGHpA
Plasmid#108824PurposeExpresses aa271 to C-terminus of Cre recombinase fused to pMag CIDDepositorInsertCre recombinase fragment aa271 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and pMagExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSD35_pCAG-PV1-TP901-N326-L1-FRB-NLS-BGHpA
Plasmid#108813PurposeExpresses N-terminus to aa326 of TP901 integrase fused to GID1 CIDDepositorInsertTP901 integrase fragment N-terminus to aa326
UseCre/Lox and Synthetic BiologyExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2690_pCAG-PV1-pMag-L1-iCre-230C-BGHpA
Plasmid#108818PurposeExpresses aa230 to C-terminus of Cre recombinase fused to pMag CIDDepositorInsertCre recombinase fragment aa230 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and pMagExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW1604_pCAG-PV1-PYL-L1-PhiC31-234C-BGHpA
Plasmid#108798PurposeExpresses aa234 to C-terminus of PhiC31 integrase fused to PYL CIDDepositorInsertPhiC31 integrase fragment aa234 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and PYLExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW1607_pCAG-PV1-PYL-L1-PhiC31-429C-BGHpA
Plasmid#108802PurposeExpresses aa429 to C-terminus of PhiC31 integrase fused to PYL CIDDepositorInsertPhiC31 integrase fragment aa429 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and PYLExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A8REH9
Plasmid#103084PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA8REH9(Cas9 coding gene from Eubacterium dolichum DSM 3991)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-K1LM04
Plasmid#103119PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertK1LM04(Cas9 coding gene from Bergeyella zoohelcum ATCC 43767)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q4A5I2
Plasmid#103125PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ4A5I2(Cas9 coding gene from Mycoplasma synoviae (strain 53))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only