-
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorInsertARAF (ARAF Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: TACGTTCTCTATCACTGATPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pML104-KanMx4
Plasmid#83476PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation.DepositorInsertKanMX4
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9
Plasmid#42230PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6-LSL (Cre dependent)Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only