We narrowed to 10,563 results for: ESP
-
Plasmid#154071PurposeExpress SARS-CoV-2 NSP1 gene along with HA and BASUDepositorInsertNsp1 (ORF1ab Severe acute respiratory syndrome coronavirus 2)
UseLentiviralExpressionMammalianAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb4-flag
Plasmid#86768PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 4 (PSMB4 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-WT-ATPIF1
Plasmid#85403PurposeRetroviral vector expressing wild type human ATPIF1DepositorAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mIRFP670nuc-TEV-Xph20-ETWV
Plasmid#133044PurposeExpresses Xph20-ETWV in mammalian cells with nuclear miRFP670 as reporterDepositorInsertXph20-ETWV
TagsNLS, TEV protease + TEV cleavage site, and miRFP6…ExpressionMammalianMutationS63KPromoterCAGAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PHD2
Plasmid#223552PurposeLentivirus transfer plasmid for expression of full length human PHD2DepositorAvailable SinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MTS-KD-c-Src-FLAG
Plasmid#44653DepositorInsertv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC) (SRC Human)
TagsFLAG tag and mitochondria-targeting sequence (MTS…ExpressionMammalianMutationchanged lysine 298 to methioninePromoterCMV promoterAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N116C-G193C
Plasmid#162580PurposeExpresses norovirus GI.1 VP1 protein with mutations N116C-G193C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 116 was mutated to Cysteine and Glycin…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2trCD45
Plasmid#203753PurposeEncodes the transmembrane domain from CD45 with mEos3.2 fused on the N terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAN19-3xFLAG-ccvTIR1-NOSt
Plasmid#108546PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 with the F79G mutation [ccvTIR1] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 [F79G] fused with 3xFLAG and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTags3xFLAGMutationChanged F79 to GAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero11
Plasmid#187928PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero11DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
CaMKIV-DCTK75E
Plasmid#126423PurposeA kinase-dead mutant of CaMK IV (C-terminal regulatory domains removed making the enzyme constitutively active)DepositorInsertcalcium/calmodulin-dependent protein kinase IV kinase-dead mutant (CAMK4 Human)
TagsFLAGExpressionMammalianMutationchanged lysine 75 to glutamic acidAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2FP
Plasmid#203757PurposeEncodes the membrane anchor of NRas, including the last 10 residues of the C terminus with 1 farnesylation and 1 palmitoylation, with mEos3.2 fused to the N terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.E2.ChETA
Plasmid#220310PurposeDirects ChETA optogenetic actuator to fast spiking interneurons in cortex. Allows for single APs to be evoked.DepositorInsertChETA
UseAAVExpressionMammalianPromoterS5E2Available SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B GG
Plasmid#89451PurposeExpression of GFP-tagged human Rab27B GG in mammalian cellsDepositorInserthuman Rab27B GG (RAB27B Human)
TagseGFPExpressionMammalianMutationGG (geranyl geranyl site is mutated)PromoterCMVAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CoV2-Omicron BA.1 spike
Plasmid#194602PurposeMammalian expression of RBD domain from SARS-CoV-2 omicron (BA.1)DepositorInsertCoV2-Omicron BA.1 spike (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q62C-A140C
Plasmid#162581PurposeExpresses norovirus GI.1 VP1 protein with mutations Q62C-A140C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 62 changed to Cysteine and Alanine 140 …PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso2 S172A
Plasmid#74392PurposeFlag tagged human S172A MFF isoform 2 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only