We narrowed to 24,315 results for: crispr
-
Plasmid#217892PurposeLentiviral vector, entry vector for Lentiviral Switch-OVERDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-AaCas12b-2AeGFP
Plasmid#121945PurposeMammalian expression, Genome editingDepositorInsertAaCas12b
Tags3xHA tagExpressionMammalianAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPbuCas13b
Plasmid#184565PurposeInducible expression of PbuCas13b nuclease in bacteria.DepositorInsertCas13b nuclease from Prevotella buccae
ExpressionBacterialPromoterT7 promoterAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pN-PITCh-FAID
Plasmid#127885PurposeProvides the repair template with PP2Ac microhomology on each end for PP2Ac N-ter FAID taggingDepositorAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-BFP
Plasmid#106282PurposeA version of the pHAGE vector with BFP and dsRed expressed separated by an IRES. Note that dsRed is not expressed.DepositorInsertCMV-BFP-IRES-DSRED(NOT-EXPRESSED)-WPRE-MCS
UseCRISPR and LentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141A2.0
Plasmid#99896PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-NLS-dHgm4Cas13b-3xGFP-NLS
Plasmid#191368PurposeOverexpression of NLS-NLS-dHgm4Cas13b-3xGFP-NLS in human cellsDepositorInsertNLS-NLS-dHgm4Cas13b-3xGFP-NLS
Tags3xGFPExpressionMammalianAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHACK(Gal4)-DONR(T2A-Cas9)
Plasmid#194768PurposeTo insert T2A-Cas9 into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-Cas9 transgene.DepositorInsertT2A-Cas9
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAWp30
Plasmid#73857PurposepFUGW-EFSp-Cas9-P2A-ZeoDepositorInsertEFSp-Cas9-P2A-Zeo
UseLentiviralAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYZ145
Plasmid#98405PurposeDonor DNA plasmid to introduce leu1 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC6
Plasmid#104780PurposepSC218UG-At Ubiquitin10:Gateway expression cassette binary vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ149
Plasmid#98407PurposeDonor DNA plasmid to introduce his3 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only