We narrowed to 25,284 results for: crispr
-
Plasmid#204303PurposeExpresses Cas9 under UAS control. HDR integrant markers with DsRed expressed in flight muscles.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMHC-DsRed
UseCRISPRPromoterMHCAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYZ675
Plasmid#132954PurposecrRNA entry vector of Pfba1-BsaI pad-TEF1 Term with dFnCas12a Schizosaccharomyces pombeDepositorInsertdFnCas12a
UseCRISPR and Synthetic BiologyTagsnucleoplasmin NLSPromoteradh1Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYZ694
Plasmid#132956PurposecrRNA entry vector of Prrk1-Not1-HHR with dFnCas12a-Clr4 in Schizosaccharomyces pombeDepositorInsertdFnCas12a
UseCRISPR and Synthetic BiologyTagsSV40 NLS and nucleoplasmin NLSPromoteradh1Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK43 pHomL-TDH3p-GFPdropout-SSA1t-HomR (AmpR)
Plasmid#179027PurposeParent vector for markerless yeast integration cassettes with untagged genesDepositorTypeEmpty backboneExpressionYeastAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAi14-GFPNLS-MC
Plasmid#87114Purposeminicircle parental backbone plasmid including GFPNLS-pA knock-in donor and one cutting site for HITIDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFPNLSPpA
UseCRISPRPromoternEFAvailable sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPE4max-Blasticidin
Plasmid#194905PurposeExpressing prime editing PE4max proteins, to work in conjunction with an epegRNA encoding plasmid or Circular Vector as described in the cited article.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBSD
ExpressionMammalianPromoterCMVAvailable sinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2 hsp70l loxP-Non-FP-loxP-nCas9n-GFP
Plasmid#158963PurposeCre-dependet Cas9-GFP expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertshsp70l promoter
floxed Non-FP cassette
Cas9-GFP
UseCRISPR and Cre/LoxAvailable sinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVS1-VIR1
Plasmid#138192PurposeVirulence helperDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertvir gene cluster
UseVir gene expressionAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT3/Cre
Plasmid#89654PurposeExpresses a non-targeting gRNA and Cre-recombinaseDepositorInsertnon-targeting gRNA
UseCre/Lox and LentiviralExpressionMammalianAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miniTurbo-dCasRx
Plasmid#219821PurposeEF1α-driven expression of miniTurbo fused to dCasRx with GFP (Adapted from plasmid #153209)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCasRx
UseCRISPRTagsminiTurboExpressionMammalianPromoterEF1a and hU6Available sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BFP Homology Donor
Plasmid#149372PurposePromoter-less BFP cDNA with two homology arms to the lenti-CDDR reporter for HDR detectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCDDR BFP Homology Donor
ExpressionMammalianAvailable sinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Bhlhe40-3xFLAG-IRES-BFP
Plasmid#117263PurposeRetroviral overexpression of Bhlhe40 with a 3xFLAGDepositorAvailable sinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-2C-NLS in pCSDest
Plasmid#126638PurposeExpresses LbCas12a-2C-NLS in mammalian cellDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLbCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianPromoterCMV IE94 promoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR1265
Plasmid#111094Purposelentiviral cDNA expression vector: plenti-x1-neo-linker-IRES-Thy1.1DepositorTypeEmpty backboneUseLentiviralAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSimpleII-U6-tracr-U6-crRNA(OCT4)-NLS-NmCas9-HA-NLS(s)
Plasmid#47870PurposeAll-in-one plasmid targeting human OCT4, cuts roughly ~84bp downstream of stop codon.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsNmCas9
U6pr-tracrRNA
OCT4 crRNA
UseCRISPRTagsHA and NLSExpressionMammalianAvailable sinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B2
Plasmid#172843PurposeCRISPIE donor B2 (Zhong et al, eLife 2021), mRuby3 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPIE designer exon (phase 0-0) encoding mRuby3
UseCRISPRAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Blast
Plasmid#227270PurposeEmpty AAVS1 targeting donor for the insertion of Blast and a medium strength PGK promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-LMNB1
Plasmid#207773PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNB1 Homology Arms flanking a Puro-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits