We narrowed to 7,181 results for: Cad
-
Plasmid#11667Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-UVRAG CC
Plasmid#24400DepositorInsertUVRAG (UVRAG Human)
TagsHisExpressionBacterialMutationContains on the CC domain, amino acids 200-270Available SinceApril 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Fah_W
Plasmid#163087Purposeexpressing mouse wild type FAH in mammalian cellsDepositorInsertFah_W
TagsMyc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-ElonginB
Plasmid#29504DepositorInsertElongin B (ELOB Human)
ExpressionInsectAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pG4-E6s-luc
Plasmid#46324DepositorInsert5xGal4
UseLuciferaseTagsE boxes and luciferaseExpressionMammalianMutationfive copies of a multimerized GAL4 (5×GAL4) site …Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag BimL (AA)
Plasmid#24240DepositorInsertBim L(AA) (BCL2L11 Human)
TagsFlagExpressionMammalianMutationchanged Threonine 56 to Alanine changed Serine …Available SinceMay 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCC20
Plasmid#198783PurposeDrives specific expression in the ASK neuronsDepositorInsertPsra-9-GAL4-SK(DBD)-VP64
ExpressionWormAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSSK p85 alpha (delta BH)
Plasmid#13431DepositorInsertp85 alpha (delta BH) (PIK3R1 Human)
TagsFLAGExpressionBacterialMutationBH domain replaced by flag tag.Available SinceNov. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-MTS-FLAG-LOV*
Plasmid#202208PurposePlasmid for the generation of a lentiviral vector encoding the photoproximity labeling catalyst LOV* fused to the mitochondria targeting sequence (MTS) in mammalian cellsDepositorInsertCytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
UseLentiviralTagsFLAG and LOV*PromoterEf1aAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only