We narrowed to 10,238 results for: ada
-
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA Td2
Plasmid#176255PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#2
Plasmid#174143PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO GLTP
Plasmid#170732PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP-MIOX
Plasmid#166682PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase fused to VP2C-GFP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Budding Yeast, Synthetic, Mouse)
UseSynthetic BiologyExpressionYeastPromoterGAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-CD55-NeoR
Plasmid#153551PurposeUsed as a donor vector for the targeted knock-in of a CD55 mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant CD55 (a 1415-bp fragment from intron 3, exon 4 and intron 4, with a 1-bp mutation in exon 4), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 1-bp mutation in exon 4PromoterNo promoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-mHdac1-L2
Plasmid#122307PurposeExpresses sgRNA targeting mouse Hdac1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Hdac1 (Hdac1 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-chiRNA_dCrkgRNA1
Plasmid#131139PurposeEncodes gRNA targeting Drosophila crk locus. Cuts 110bp upstream of the transcription start site. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-chiRNA_dCrkgRNA2
Plasmid#131140PurposeEncodes gRNA targeting Drosophila crk locus. Cuts 99bp beyond the 3' UTR. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).DepositorAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mAmber
Plasmid#105792PurposeExpression of your protein of interest in fusion with non-absorbing, non-emitting Venus mutant at the C-terminus (cleavable by TEV). Negative control for FRET measurements (PMID: 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mAmberExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mAmber-TEV
Plasmid#105775PurposeExpression of your protein of interest in fusion with non-absorbing, non-emitting Venus mutant at the N-terminus (cleavable by TEV). Negative control for FRET measurements (PMID: 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsmAmber-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLuc-Optop38i-lsm
Plasmid#89747PurposeExpression of light-regulated p38 inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor MK3BD3-13FDepositorInsertOptop38i lit-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationI539E mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only