We narrowed to 7,583 results for: ef1a;
-
Plasmid#184944PurposeLentiviral delivery of recombinase landing padDepositorInsertBxBi Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT306 Kp03 Lenti pEF-attB LSR GFP
Plasmid#184949PurposeLentiviral delivery of recombinase landing padDepositorInsertKp03 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1α-sakkhCas9-HA-NLS-polyA-CBh-EGFP-polyA
Plasmid#168305Purposemediated knock-in of sgRNA precursorDepositorInsertSaKKH-EGFP-U6-sgRNA
UseAAVExpressionMammalianPromoterEF1alpha, CBhAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX311-Cas9
Plasmid#118018PurposeConstitutive expression of Cas9DepositorInsertCas9
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A-HAUS6_IRES_Blast
Plasmid#182886PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (WT full length)DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralTagsEGFPExpressionBacterial and MammalianPromoterEF1alpha coreAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT302 Ec03 Lenti pEF-attB LSR GFP
Plasmid#184945PurposeLentiviral delivery of recombinase landing padDepositorInsertEc03 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT303 Ec04 Lenti pEF-attB LSR GFP
Plasmid#184946PurposeLentiviral delivery of recombinase landing padDepositorInsertEc04 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR100
Plasmid#187240PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT304 Ec07 Lenti pEF-attB LSR GFP
Plasmid#184947PurposeLentiviral delivery of recombinase landing padDepositorInsertEc07 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ853
Plasmid#208115PurposemSwAP-In marker cassette 2 with 5’PB-mNeongreen-HPRT1-BSDDepositorInsertmNeonGreen-HPRT1-BSD
TagsT2AExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX209-neo-HA-Ub-T2A-Tet3G
Plasmid#202436PurposeBicistronic expression of HA-tagged Ubiquitin (HA-Ubiquitin) and Tet-On 3G transactivator (Tet3G)DepositorInsertUbiquitin
UseCRISPR and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DM
Plasmid#64880Purposelentiviral expression of human POLQ double mutant (in POL and HDL domains)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M and D2330A,Y2331APromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV_PP1-mCitrine
Plasmid#172472PurposeMammalian expression of a human codon-optimized version of the optogenetic GPCR parapinopsina (PP1) from zebrafish fused to mCitrine. Also contains an N-terminal prolactin signal sequence.DepositorInsertprolactinSS-PP1-mCitrine (parapinopsina Zebrafish)
UseLentiviralTagsmCitrine and prolactin signal sequence (cleaved p…ExpressionMammalianPromoterEF1alphaAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-full-length-CHMP3-HA
Plasmid#154176Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
L4866 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF1a in MGEV
Plasmid#244190PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF1aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF1 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4864 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF6a in MGEV
Plasmid#244189PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF6aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4207 TNFR2 NTEVp chain in PolyTX-mNeonGreen
Plasmid#244175PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, and NTEVp (75S) (TNFRSF1B Human, Synthetic)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only