We narrowed to 8,911 results for: LIC
-
Plasmid#203960PurposeCloning plasmid containing the tetracycline resistance gene insertDepositorInsertTetracycline Resistance Gene
ExpressionPlantPromoterCAT promoterAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo12
Plasmid#203982PurposeCloning plasmid containing the rrnB T1 terminator insert with a chloramphenicol resistance markerDepositorInsertrrnB T1 Terminator
ExpressionPlantPromoterN/AAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Bn CAAX pcDNA3
Plasmid#206088PurposeCav2.2 N-terminus (amino acids 1-95) with a C-terminal tag of the final 10 aa of H.Ras containing CAAX motifDepositorAvailable sinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Shim_ProRS_TP_GFP_pK7FWG2
Plasmid#202651PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic ProRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_ThrRS_TP_GFP_pK7FWG2
Plasmid#202652PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic ThrRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_TrpRS_TP_GFP_pK7FWG2
Plasmid#202653PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic TrpRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_AspRS_TP_GFP_pK7FWG2
Plasmid#202647PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic AspRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_GlyRS_TP_GFP_pK7FWG2
Plasmid#202648PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic GlyRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_AsnRS_TP_GFP_pK7FWG2
Plasmid#202649PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic AsnRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_MetRS_TP_GFP_pK7FWG2
Plasmid#202650PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic MetRS
TagsGreen Florescent ProtienExpressionPlantAvailable sinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTC3cIfm
Plasmid#193778PurposeExpresses frame-shifted cI under the control of PLTetO-1 promoter, p15A origin of replication, Chloramphenicol selectionDepositorInsertFrame-shifted CI
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1Available sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
GLRX-roGFP2 in pT3TS-Dest
Plasmid#194297PurposeIn vitro transcription of the redox sensor GLRX-roGFP2 from the T3 promoter. Parton lab clone KRKDepositorPublicationInsertGLRX-roGFP2
UseIn vitro transcription of mrnaAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1a
Plasmid#194291PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1a with fusion tag at the N-terminus. Parton lab clone KXMDepositorPublicationInsertcavin1a (cavin1a Zebrafish)
UseMultisite gateway entry vectorAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
RP51A-NoBS-NoPseudoBS
Plasmid#100986PurposeRP51A w/ T7 promoter in HindIII/EcoRI sites of pUC18. Has WT 5'ss but mutant BS and no pseudo BSDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationBS mutated to GTTAGTG, pseudo BS mutated to GTTTG…Available sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA KanR neo_TtoC and hairpin extension
Plasmid#167925PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mPpp3r2
Plasmid#179161PurposeExpression vector of mouse protein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2 Mouse)
ExpressionMammalianAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC018.AAV
Plasmid#171146PurposeExpression of J1-BBa_J23117-mRFP and hAAVS1 scRNA on pRK2-GmR plasmidDepositorInsertshAAVS1 scRNA
J1-BBa_J23117-mRFP
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J1-BBa_J23117Available sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJAID5WY
Plasmid#165050PurposeIntegrative expression of SOD1-AID* (mini auxin inducible degron)-yEGFP and rice auxin receptor gene OsTIR1.DepositorInsertP-URA3>KlURA3>T-AgTEF1-P-TEF1>SOD1-AID*>yEGFP>T-PGK1-P-ACS2>OsTIR1opt>T-URA3
ExpressionYeastMutationOsTIR1 is codon-optimised for expression in S. ce…Available sinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBEAST_J23101-vdh
Plasmid#128134PurposeThe cell-free adapted backbone, pBEAST, expressing vdh (the enzyme converting benzaldehyde to benzoate) under control of the constitutive promoter J23101, and RBS B0032DepositorInsertvdh
UseSynthetic BiologyExpressionBacterialPromoterJ23101Available sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only