We narrowed to 24,713 results for: c-myc
-
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHACK(Gal4)-DONR(T2A-Flp1)
Plasmid#194770PurposeTo insert T2A-Flp1 into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-Flp1 transgene.DepositorInsertT2A-Flp1
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hMed25
Plasmid#206958PurposeThe ORF of human Med25 cDNA amplified from the RT human liver RNA was cloned into pGEMTE vector and then subclone at XhoI/XbaI sites of the pcDNA3.2(+), the mammalian expression vector.DepositorInsertHomo sapiens mediator complex subunit 25 (MED25), transcript variant 1, mRNA (MED25 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJP118
Plasmid#176494PurposeExpresses Lifeact-mScarlet under control of the Capsaspora EF1 promoter and HygR under control of the Capsaspora actin promoterDepositorInsertLifeact peptide
UseCapsaspora owczarzaki expressionAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-) Full length Her2(ERBB2)-Fc
Plasmid#194330PurposeMammalian expression of full length Human epidermal growth factor (Her)-2-Fc fusion proteinDepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOn-puro-ICP4-∆CTA
Plasmid#250613PurposeMammalian lentiviral vector for the inducible (TetOn) expression of codon-optimized HSV-1 ICP4 lacking the entire C-terminus (from HSV-1 n208 virus)DepositorInsertICP4-n208
UseLentiviralExpressionMammalianMutationCodon-optimized ICP4 is truncated after first 774…PromoterTRE3GS promoterAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNLF1-C_PRKCSH:1-527
Plasmid#211091PurposeMammalian expression of full-length human PRKCSH. C-terminal NanoLuc luciferase tag.DepositorInsertPRKCSH:M1-L527 (PRKCSH Human)
TagsNanoLuc luciferaseExpressionMammalianMutation333-333: missing. A291T natural variant (VAR_028…PromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
FRB-TagRFPT-CAAX
Plasmid#87710PurposeFRB-tagged TagRFPT; targeted to plasma membrane.DepositorInsertFRB-TagRFPT-CAAX
Tags6xHis, C-terminal targeting sequence from Kras, T…ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCardinal-Farnesyl-5
Plasmid#56159PurposeLocalization: Plasma Membrane, Excitation: 604, Emission: 659DepositorInsertFarnesyl (HRAS Human)
TagsmCardinalExpressionMammalianMutationencodes final 20 aa of NM_001130442.1PromoterCMVAvailable SinceFeb. 27, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLX307 HRAS
Plasmid#117748PurposeOpen reading frame vector encoding HRASDepositorInsertRASH1 (HRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationClosed vector so will not read through the V5 reg…PromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459_GNB1L_gRNA
Plasmid#224377PurposeTargets GNB1L for dTAG C terminal knock-in cell linesDepositorAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only