We narrowed to 7,887 results for: 11
-
Plasmid#196020PurposeExpresses Expresses CRKL W160L + Y207FDepositorInsertCRKL
UseRetroviralAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsEDC4_1-538_AA
Plasmid#148285PurposeMammalian Expression of HsEDC4_1-538DepositorInsertHsEDC4_1-538 (EDC4 Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA (A11P/V70P)
Plasmid#185717PurposeAAV expression of GFP and human α-Synuclein with A11P and V70P mutations from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVMutationChanged Ala 11 to Pro, Val 70 to ProPromoterhSynAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO FAPP2-GLTPH
Plasmid#170739PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0007
Plasmid#102839PurposeBinary vector containing Sr22 PI573523 allele driven by Sr33 promoter, Sr33 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0002
Plasmid#102834PurposeBinary vector containing Sr22 Schomburgk allele driven by Sr33 promoter, Sr33 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0003
Plasmid#102835PurposeBinary vector containing Sr22 Schomburgk allele driven by Sr33 promoter, Sr22 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0004
Plasmid#102836PurposeBinary vector containing Sr22 PI190945 allele driven by Sr33 promoter, Sr33 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0005
Plasmid#102837PurposeBinary vector containing Sr22 PI573523 allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW_0006
Plasmid#102838PurposeBinary vector containing Sr22 Schomburgk allele driven by Sr33 promoter, Sr33 promoter (undomesticated)DepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMGF169
Plasmid#96996Purposeish1 mCherry insertion cassette with G418 resistance geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + G418 …PromoterN/AAvailable SinceAug. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
csd5_41-192/pET28b(+)
Plasmid#83296Purposecsd5, construct: 41-192, pET28b(+) N-tagDepositorInserthp1250
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-40Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
csd4_22-438/pET28b(+)
Plasmid#83295Purposecsd4, construct: 22-438, pET28b(+) N-tagDepositorInserthp1075
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-21Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A C-Term
Plasmid#69795PurposePebble isoform A, C-Term, in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble C-Term domain (Drosophila guanine nucleotide exchange factor)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutationJust the C-Term domain of Pebble (pbl)Promoterhsp70 promoterAvailable SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
1.2 hA33 luciferase
Plasmid#68149Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -1149 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
0.6 hA33 luciferase
Plasmid#68150Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -595 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
0.44 hA33 luciferase
Plasmid#68151Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -443 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
0.42 hA33 luciferase
Plasmid#68152Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -423 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
0.41 hA33 luciferase
Plasmid#68154Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -405 relative to ATGPromoterhuman GPA33 promoterAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only