We narrowed to 14,052 results for: crispr grnas
-
Plasmid#197860PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFYF1548 EMX1
Plasmid#47508Purposehuman gRNA expression vector targeting EMX1DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 16x(MS2) MUC4.1
Plasmid#101154PurposegRNA with 16 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDuRCC-K
Plasmid#81193PurposeExpression of Cas9 and two gRNA cassettes in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below., Please view…PromoterROX3 and SNP52pAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM
Plasmid#92220PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sitesDepositorInsertsSp-dCas9-2xAM tag
gRNA to be inserted into Bbs I sites
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDuRCC-N
Plasmid#81194PurposeExpression of Cas9 and two gRNA cassettes in S. cerevisiae; Nourseothricin ResistanceDepositorInsertsCas9
empty gRNA cassette
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease view depositor comments below and WT - cod…PromoterROX3 and SNP52pAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-UGCG-KO
Plasmid#80010PurposegRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.DepositorInsertUGCG (UGCG Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_INT
Plasmid#68436PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-EEA-guide1-PGK-Puro
Plasmid#102904PurposeEBNA episome plasmid for U6 promoter-driven expression of a gRNA targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-EEA-g1-PGK-Puro
Plasmid#102908PurposePiggyBac transposon system construct for U6 promoter-driven expression of a gRNA targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
sg2.0 (PP7) Locus#2
Plasmid#101155PurposegRNA with two PCP binding sitesDepositorInsertLocus #2(tandem repeat)
UseCRISPR and LentiviralPromoterhU6Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-TdT-guide1-PGK-Puro
Plasmid#102903PurposeEBNA episome plasmid for U6 promoter-driven expression of a control gRNA targeting TdTomato sequence. Includes PGK-puro selection cassette.DepositorInsertTdT-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-ACTC1-Puro
Plasmid#128326PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse ACTC1 for activation (Actc1 Mouse)
ExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 sgAAVS1
Plasmid#127099PurposeEncodes gRNA for human AAVS1.DepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only