We narrowed to 10,360 results for: epo
-
Plasmid#231596PurposeExpress high ribosome loading circular RNA translation reporter 2xALFATag-10xSunTag-2xXbp1(S255A) pause site under H1 promoterDepositorInsertKozak sequence-Tornado-2xALFATag-10xSunTag-2xXbp1(S255A) pause sequence
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry
Plasmid#229135PurposeRetrovirus driving mCherry reporterDepositorInsertmCherry
UseRetroviralExpressionMammalianAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC2.4
Plasmid#226557PurposeNATURA gene encoding plasmidDepositorInsertNATURA reporter gene
UseLuciferase; PiggybacTagsEGFP and FlagExpressionMammalianPromoterEF1alphaAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
TAK4
Plasmid#227094PurposeLuciferase reporter vector with MMTV 5' Element cloned downstream of luciferase gene in pHMRΔelucDepositorInsertMMTV insert spanning from R region to 400 bp of Gag
UseLuciferaseAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIE324-ZF6x12-C DsRed-Express2 in TUPV1
Plasmid#201536PurposeDsRed-Express2 reporter regulated by ZF6 synTF promoter (12x compact binding sites) in TUPV1 for mMoClo golden gate-based assemblyDepositorInsertDsRed-Express2
ExpressionMammalianPromoterZF6x12(C)_YB_TATA Minimal PromoterAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC1484-luc2
Plasmid#227138PurposeBarcoded assay, MAPK sensor; barcode BC1484DepositorInsertEGR1 promoter driving barcode 1484 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC0136-luc2
Plasmid#227137PurposeBarcoded assay, MAPK sensor; barcode BC0136DepositorInsertEGR1 promoter driving barcode 0136 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHPHS927
Plasmid#228238PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible β-globin reporter for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
Beta globin
Tags3xFLAG, HA, and PuroRExpressionMammalianPromoterTRE3GV and noneAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC0132-luc2
Plasmid#227136PurposeBarcoded assay, MAPK sensor; barcode BC0132DepositorInsertEGR1 promoter driving barcode 0132 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426
Plasmid#226734PurposeExpresses a reporter for an alpha-helical OMM proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p40651-EFSNS-FMR1_e1-24xms2
Plasmid#222968PurposeMS2 mRNA reporter with intact FMR1 5' UTR and exon 1 sequenceDepositorInsertFMR1-31CGG 5' UTR and exon1
ExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP_C1_ATRX
Plasmid#221383PurposeExpresses ATRX in mammalian cellsDepositorInsertTranscriptional regulator ATRX (ATRX Human)
ExpressionMammalianMutationK536N (Please see depositor comments)PromoterCMVAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP8f L27A
Plasmid#204140PurposeFluorescent reporter for calcium imaging in mammalian cells - jGCaMP8f with L27A mutationDepositorInsertjGCaMP8f L27A
TagsN-terminal His tagExpressionMammalianMutationLeucine 27 changed to AlaninePromoterCMVAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only