We narrowed to 5,551 results for: crispr cas9 grna plasmid

#207093

pX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 30, 2025

Academic Institutions and Nonprofits only

#176236

Plasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.

Baisong Lu

Yoo et al Nucleic Acids Res. 2022 Mar 22. pii: 655

March 30, 2022

Academic Institutions and Nonprofits only

#176237

Plasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.

Baisong Lu

Yoo et al Nucleic Acids Res. 2022 Mar 22. pii: 655

March 30, 2022

Academic Institutions and Nonprofits only

#176238

Plasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.

Baisong Lu

Yoo et al Nucleic Acids Res. 2022 Mar 22. pii: 655

March 30, 2022

Academic Institutions and Nonprofits only

#246403

Cas9/sgRNA expression plasmid targeting PHF1

Yicheng Long

Much et al Mol Cell. 2025 Aug 7:S1097-2765(25)00615

Nov. 7, 2025

Academic Institutions and Nonprofits only

#122852

Expresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum TK gene

David Sibley

Wilke et al Cell Host Microbe. 2019 Jun 18. pii: S19

July 11, 2019

Academic Institutions and Nonprofits only

#122853

Expresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT gene

David Sibley

Wilke et al Cell Host Microbe. 2019 Jun 18. pii: S19

July 11, 2019

Academic Institutions and Nonprofits only

#240044

Knockdown expression of Gabbr1

Huaibin Cai

Dong et al Nat Commun. 2025 Mar 19;16(1):2710. doi:

Jan. 6, 2026

Academic Institutions and Nonprofits only

#117687

U6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.

Erik Sontheimer

Gao et al Methods Enzymol. 2019;616:365-383. doi:

Dec. 17, 2018

Academic Institutions and Nonprofits only

#135964

Expresses SauriCas9, and cloning backbone for sgRNA

Yongming Wang

Hu et al PLoS Biol. 2020 Mar 30;18(3):e3000686. d

April 9, 2020

Academic Institutions and Nonprofits only