Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
(Plasmid #117687)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117687 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7183
  • Total vector size (bp) 9614
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Use FACS to sort out BFP positive cells.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Kanamycin cassette
  • Species
    Bacterial origin
  • Insert Size (bp)
    1054
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspMI (destroyed during cloning)
  • 3′ cloning site BspMI (destroyed during cloning)
  • 5′ sequencing primer gcatatacgatacaaggctgt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TetR-P2A-BFP
  • Species
    Synthetic
  • Insert Size (bp)
    1437
  • Promoter hPGK

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA was a gift from Erik Sontheimer (Addgene plasmid # 117687 ; http://n2t.net/addgene:117687 ; RRID:Addgene_117687)
  • For your References section:

    Adapting dCas9-APEX2 for subnuclear proteomic profiling. Gao XD, Rodriguez TC, Sontheimer EJ. Methods Enzymol. 2019;616:365-383. doi: 10.1016/bs.mie.2018.10.030. Epub 2018 Dec 10. 10.1016/bs.mie.2018.10.030 PubMed 30691651