This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEJS578_DD-dSpyCas9-mCherry-APEX2
(Plasmid #108570)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108570 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 12774
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dSpyCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4113
  • Promoter CMV
  • Tags / Fusion Proteins
    • Destabilization domains (N terminal on insert)
    • mCherry (C terminal on insert)
    • Flag (C terminal on insert)
    • APEX2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

CRISPR-Cas9 nuclear dynamics and target recognition in living cells. Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., and Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. The Journal of Cell Biology 214, 529–537.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS578_DD-dSpyCas9-mCherry-APEX2 was a gift from Erik Sontheimer (Addgene plasmid # 108570 ; http://n2t.net/addgene:108570 ; RRID:Addgene_108570)
  • For your References section:

    C-BERST: defining subnuclear proteomic landscapes at genomic elements with dCas9–APEX2. Gao , Xin D., Li-Chun Tu, Aamir Mir, Tomás Rodriguez, Yuehe Ding, John Leszyk, Job Dekker, Scott A. Shaffer, Lihua Julie Zhu, Scot A. Wolfe & Erik J. Sontheimer. Nature Methods (2018) 10.1038/s41592-018-0006-2