Skip to main content

pEJS578_DD-dSpyCas9-mCherry-APEX2
(Plasmid #108570)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108570 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 12774
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dSpyCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4113
  • Promoter CMV
  • Tags / Fusion Proteins
    • Destabilization domains (N terminal on insert)
    • mCherry (C terminal on insert)
    • Flag (C terminal on insert)
    • APEX2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pHAGE-TO-DD-dCas9-mCherry was a gift from David Grunwald lab (published in Ma et al J. Cell Biol. 2016).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CRISPR-Cas9 nuclear dynamics and target recognition in living cells. Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., and Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. The Journal of Cell Biology 214, 529–537.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS578_DD-dSpyCas9-mCherry-APEX2 was a gift from Erik Sontheimer (Addgene plasmid # 108570 ; http://n2t.net/addgene:108570 ; RRID:Addgene_108570)
  • For your References section:

    C-BERST: defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2. Gao XD, Tu LC, Mir A, Rodriguez T, Ding Y, Leszyk J, Dekker J, Shaffer SA, Zhu LJ, Wolfe SA, Sontheimer EJ. Nat Methods. 2018 Jun;15(6):433-436. doi: 10.1038/s41592-018-0006-2. Epub 2018 May 7. 10.1038/s41592-018-0006-2 PubMed 29735996