We narrowed to 8,472 results for: chloramphenicol
-
Plasmid#208409PurposeLentivirus compatible with LR Gateway cloning for UBC-driven gene expression with CMV-RFP in backboneDepositorArticleTypeEmpty backboneUseLentiviral; Gateway: dest vectorPromoterUBCAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only
-
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2-3a_004_atpA_Promoter+5'UTR_Cr
Plasmid#235876PurposeatpA promoter + 5'UTR Chlamydomonas reinhardtii 2-3aDepositorInsertatpA promoter + 5'UTR
UseSynthetic BiologyAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_G_0_2-3_005_Promoter+5'UTR_Placeholder
Plasmid#235870PurposeEncodes a sfGFP cassette in the promoter+5'UTR position used for placeholder cloningDepositorInsertPromoter + 5'UTR placeholder
UseSynthetic BiologyMutationnoneAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-chKlacRS-WT
Plasmid#232159PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.DepositorInsertchKlacRS-WT
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-chKlacRS-IPYE
Plasmid#232160PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.DepositorInsertchKlacRS-IPYE
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_010_psbD_5'Hom_Cr
Plasmid#235788Purpose5' Homology psbD in the M1 position used for genome integration at the psbD locusDepositorInsert5' Homology region of the psbD locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_005_rbcL_5'Hom_Cr
Plasmid#235786Purpose5' Homology rbcL in the M1 position used for genome integration at the rbcL locusDepositorInsert5' Homology region of the rbcL locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2-3a_002_psbD_Promoter+5'UTR_Cr
Plasmid#235874PurposepsbD promoter + 5'UTR Chlamydomonas reinhardtii 2-3aDepositorInsertpsbD promoter + 5'UTR
UseSynthetic BiologyAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2-3a_003_rbcL_Promoter+5'UTR_Cr
Plasmid#235875PurposerbcL promoter + 5'UTR Chlamydomonas reinhardtii 2-3aDepositorInsertrbcL promoter + 5'UTR
UseSynthetic BiologyAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_001_psbH_5'Hom_Cr
Plasmid#235784Purpose5' Homology psbH in the M1 position used for genome integration at the psbH locusDepositorInsert5' Homology region of the psbH locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_004_psbA_5'Hom_Cr
Plasmid#235785Purpose5' Homology psbA in the M1 position used for genome integration at the psbA locusDepositorInsert5' Homology region of the psbA locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_007_petB_5'Hom_cr
Plasmid#235787Purpose5' Homology petB in the M1 position used for genome integration at the petB locusDepositorInsert5' Homology region of the petB locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_Z11 gpN:SpyTag
Plasmid#225196PurposeUsed for adding C-terminal SpyTag to the Plesiomonas ZOR0011 P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Puro-DEST (JDW 925)
Plasmid#229808PurposeA puromycin selectable, PiggyBac destination vector compatible with 4-way multi-site gateway cloning systemDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-DEST (JDW 1205)
Plasmid#229821PurposeA PiggyBac destination vector compatible with gateway cloning system.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Neo-DEST (JDW 940)
Plasmid#229825PurposeA neo selectable, PiggyBac destination vector compatible with gateway cloning system.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXMLC2-DEST (JDW 7)
Plasmid#229833PurposeA gateway compatible destination vector containing the Xenopous myosin light chain 2 promoter for embryonic and adult cardiomyocyte expression.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only