We narrowed to 16,746 results for: CAN
-
Plasmid#116440PurposeLentiviral expression of NOTCH2NL Q172_G173delinsHCDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pHAGE-NOTCH2NL-R87M
Plasmid#116441PurposeLentiviral expression of NOTCH2NL R87MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-S165F
Plasmid#116442PurposeLentiviral expression of NOTCH2NL S165FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L-L57F
Plasmid#116445PurposeLentiviral expression of OXA1L L57FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L-P58S
Plasmid#116446PurposeLentiviral expression of OXA1L P58SDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPANXN4_WT
Plasmid#81998PurposeGateway Donor vector containing SPANXN4, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FAM200A_WT
Plasmid#81878PurposeGateway Donor vector containing FAM200A ,part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPATA8_WT
Plasmid#81866PurposeGateway Donor vector containing SPATA8 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only