We narrowed to 8,724 results for: gal
-
Pooled Library#241289PurposeLibrary of pBD-PYR1 double site mutants for yeast-based screens; redesigned to remove constitutive mutants and wild type rceptorsDepositorExpressionYeastSpeciesArabidopsis thalianaAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only
-
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGST-DHFR Mm
Plasmid#83073PurposeExpresses the full length DHFR Mm in E.coliDepositorAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB-Gaolf-Integration
Plasmid#129456PurposepiggyBac transposon vector that Inducibly (Tet-On) expresses GaolfDepositorAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pME_Golgi-BFP_P2A_H2A_iRFP (JDW 1007)
Plasmid#224490PurposeGateway compatible middle entry clone containing GalT-mTagBFP-HA-P2A-H2A-iRFP (BFP golgi reporter and infrared RFP nuclear reporter)DepositorInsertGolgi-mTagBFP-P2A-H2A-iRFP
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEXPqcxip-hCCDC47-FLAG
Plasmid#159141PurposeHu CCDC47 -flag mammalian expression Gateway vector.DepositorInsertcoiled-coil domain containing 47 (CCDC47 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterCMV (cytomegalovirus) enhancer and the MSV (mouse…Available SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ash-mCerulean
Plasmid#69579PurposeExpresses p53 tagged with mCeruleanDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmCeruleanExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ash-mKate2-splitmVenusC
Plasmid#69583PurposeExpresses p53 tagged with mKate2 and split C-term mVenusDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Gnaq
Plasmid#170298PurposeEncoding mouse GnaqDepositorInsertA recombinant mouse Gnaq (Gnaq Mouse)
TagsN/AExpressionMammalianMutationAsilent mutation was introduced into the sgRNA-ta…Available SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pX020
Plasmid#167146PurposeMoClo-compatible Level 0-CDS1 promoterless vector encoding Neonothopanus nambi caffeoylpiruvate nnCPH codon-optimised for expression in Nicotiana benthamianaDepositorInsertfungal caffeoylpiruvate hydrolase, nnCPH
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer
Plasmid#66779PurposeThe rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signalingDepositorInsertshbeRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pCRISPaint-T2A-Cas9-T2A-GFP-3xP3-RFP
Plasmid#127560PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-Cas9-T2A-GFP-SV40 and 3xP3-RFP visible eye marker.DepositorInsertCas9-T2A-GFP
UseCRISPRExpressionInsectMutationEGFP-D102G see depositor comments belowAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-HsAIDSc
Plasmid#60810Purposeto express human AID recoded for yeast codon usageDepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO Myc ArB WT RNAiR
Plasmid#59806PurposeAllows the integration of Myc ArB in the genome and Tet-inducible expression.DepositorInsertAurora B (AURKB Human)
TagsMycExpressionMammalianMutationRNAi resistantPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase Non-Cleavable
Plasmid#59826PurposeAllows the integration of myc Separase Non-Cleavable in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationNon-Cleavable (E1483R, R1486E, E1503R, R1506E, E1…Promoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -