We narrowed to 3,932 results for: biorxiv
-
Plasmid#218755PurposeProvides NOT intersectional (Flp NOT Cre) expression of TVA-mCherryDepositorInsertTVA-mCherry
UseAAVTagsmCherryPromoterhSynAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-CoffFon-eGFP-W3SL
Plasmid#218750PurposeProvides NOT intersectional (Flp NOT Cre) expression of eGFPDepositorInserteGFP
UseAAVPromoterhSynAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
mc2 mNeon hPGK
Plasmid#206230PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable sinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
mc2 neo EF1a
Plasmid#206220PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable sinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
mc2 mCherry
Plasmid#206219PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable sinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL2_166
Plasmid#199098PurposeLevel 2 plasmid, barcoded ORI with gentamicin resistance cassette and mScarlet-I reporterDepositorPublicationInsertRK2 ORI plus NGS barcode 12, gentamicin resistance cassette, mScarlet-I cassette, oriT
UseSynthetic BiologyAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL2_167
Plasmid#199099PurposeLevel 2 plasmid, barcoded ORI with gentamicin resistance cassette and mScarlet-I reporterDepositorPublicationInsertpBBR1 ORI plus NGS barcode 13, gentamicin resistance cassette, mScarlet-I cassette, oriT
UseSynthetic BiologyAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL2_163
Plasmid#199095PurposeLevel 2 plasmid, barcoded ORI with gentamicin resistance cassette and mScarlet-I reporterDepositorPublicationInsertpAMβ1 ORI plus NGS barcode 3, gentamicin resistance cassette, mScarlet-I cassette, oriT
UseSynthetic BiologyAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-8xGTIIC-mScarlet-NLS-PEST
Plasmid#249724PurposeNuclear-localized fluorescent reporter of YAP/TAZ activity driven by promoter with TEAD binding sitesDepositorInsertYAP-TEAD responsive promoter (YAP1 Human)
UseLentiviralTagsmScarlet3-NLS-PESTExpressionMammalianAvailable sinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-EF1a-fDIO-mCherry-LATeNT
Plasmid#240991PurposeFlp-dependent expression of LATeNTDepositorInsertmCherry-V5-LATeNT
UseAAVTagsV5 (internal)ExpressionMammalianAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-puro-OsAID (p5109)
Plasmid#239359PurposepPOTv7 based plasmid template for addition of a Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorPublicationInsertRice Auxin Inducible Degradation domain
UseBacterialPromoternoneAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_CKAR3
Plasmid#238411PurposeMammalian expression of CKAR3 under a CMV promotor.DepositorInsertCKAR3 (PKC sensor)
ExpressionMammalianAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-EgI-BlastR
Plasmid#207176PurposeGateway compatible Lentiviral Expression Plasmid EF1a-IRES-BlastRDepositorPublicationTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-EgI-ZeoR
Plasmid#207178PurposeGateway compatible Lentiviral Expression Plasmid EF1a-IRES-ZeoRDepositorPublicationTypeEmpty backboneUseLentiviralExpressionMammalianPromoterEf1aAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJAT75
Plasmid#204306PurposeFlippase under heat shock control. HDR integrant marked with ie1-EGFP, expressed in abdomen and mouthpartsDepositorPublicationInsertie1-EGFP
UseCRISPRPromoterie1Available sinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_MegaB-S9G-R31L-R85L_MegaRNFGLSKJTU_Bba-B0015
Plasmid#202025PurposeExpresses Bacillus megaterium ARG cluster (GvpB S9G-R31L-R85L mutant) in E. coliDepositorPublicationInsertBacillus megaterium ARG cluster (GvpB S9G-R31L-R85L mutant)
ExpressionBacterialMutationGvpB S9G-R31L-R85LAvailable sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tol2_B-act_dCas9-Vp64-T2A-Citrine
Plasmid#200248PurposeZebrafish transgenics; Plasmid encodes dCas9-Vp64 and could be stably integrated in the zebrafish genome using Tol2 transgenesisDepositorPublicationInsertdCas9-Vp64-T2A-Citrine
UseZebrafish expressionAvailable sinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-OTX2-P2A-mCherry BlastR
Plasmid#186741PurposeDox inducible OTX2-P2A-mCherry expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-osTIR1-9xMyc-Zeo
Plasmid#225696PurposeLentiviral expression of 9xMycTag fused osTIR1and Zeocin resistance. For use with AID degron.DepositorInsertosTIR1
UseLentiviral and Synthetic BiologyTags9X MycExpressionMammalianAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only