We narrowed to 10,073 results for: CAG
-
Plasmid#131051PurposeSOX17 Knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pYJ08-CRISPR-SOX17-E1-gRNA1
Plasmid#131053PurposeSOX17 Knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1846
Plasmid#235714PurposeExpression of mCherry-human Beclin 1 in mammalian cellsDepositorAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SOX2_HDR
Plasmid#163752PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.DepositorAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-Tag-HA
Plasmid#218188PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFOS-FRB-VP16-P2A-EGFP
Plasmid#210510Purposeexpresses cFOS-FRB-VP16 and EGFP component in rat hippocampal neuron cellsDepositorInsertFRB-VP16-P2A-EGFP
UseAAVExpressionMammalianPromotercFosAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 hygro sgUCK1
Plasmid#211524PurposeDeletes UCK1DepositorInsertsgUCK1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF1081
Plasmid#143757PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1080
Plasmid#142723PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#1/Cre
Plasmid#193246PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-3
Plasmid#180393PurposeProducing AAV that encodes mouse Stk16 shRNA-2 with miR-E backboneDepositorAvailable sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-ALDH1A3gRNA3
Plasmid#189748PurposeThe construct was used for expression of gRNA for knocking out of the ALDH1A3 gene in Cas9 expressing cells.DepositorInsertALDH1A3 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#1
Plasmid#163400PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorAvailable sinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
WIPI2d-TEVcs-TSF
Plasmid#171419PurposeFor the purifcation of WIPI2d proteinDepositorInsertWIPI2d (WIPI2 Human)
ExpressionMammalianAvailable sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL581 GA
Plasmid#126951PurposeTo target a protospacer with GA at the cut site.DepositorInsertspacer against human genome with GA at cut site
ExpressionMammalianPromoterhuman U6Available sinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -