We narrowed to 166,303 results for: addgene
-
Plasmid#118595PurposeOne of three plasmids required to create CDK1as human cells by single transfection (One shot system). CDK1as cDNA and puromycin resistance cassette flanked by Sleeping Beauty transposon.DepositorInsertCDK1
ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-Venus-Akaluc (neo)
Plasmid#124701PurposeAka-Luciferase reporterDepositorInsertVenus-Akaluciferase
UseLentiviralPromoterhPGKAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
YopH (residues 164-468)
Plasmid#79749PurposeThis plasmid encodes the active catalytic domain (amino acid residues 164-468) of YopH. Inteded for co-expression with human Tyr kinase plasmids to enhance bacterial kinase expression.DepositorInsertYopH (residues 164-468)
ExpressionBacterialPromoterT7Available SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Puro-miniAAVR-FLAG
Plasmid#166717PurposeVector expressing a minimal AAVR (KIAA0319L) construct PKD1-3 with a C-terminal Flag tagDepositorInsertminiAAVR-FLAG
UseLentiviralTagsFLAGExpressionMammalianMutationOnly expressing PKD1-3 of ectodomainPromoterCMVAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
NEK7_HUMAN_D0
Plasmid#79735PurposeThis plasmid encodes the kinase domain of NEK7. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000563266)
Plasmid#80036Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-KRAB-GFP backbone
Plasmid#194281PurposeVector for CRISPRi-GFP expression ready for gateway cloning of sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
araBAD-BCD20-ClpP-BCD17-ClpX
Plasmid#153301PurposeExpresses clpX and clpP in E.ColiDepositorExpressionBacterialPromoteraraBADAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGFP-NT1
Plasmid#46914PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)DepositorInsertsgGFP-NT1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pDY1513 AAVS1 sgRNA
Plasmid#234832PurposesgRNA for AAVS1 STITCHR insertionDepositorInsertAAVS1 sgRNA
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWPI-GFP-3xFLAG
Plasmid#201639PurposeOver-expression of 3xFLAG-tagged GFPDepositorInsertGFP
UseLentiviralTags3xFLAGAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pBA439
Plasmid#85967PurposePerturb-seq vector backboneDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX302 ID2-V5 puro
Plasmid#83096PurposeLentiviral vector for constitutive expression of human ID2 with C-terminal V5 tagDepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #1
Plasmid#83086PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
T-2A-EGFP-PGK-Puro
Plasmid#83344PurposeDonor vector to knocin EGFP into human Brachyury(T) locusDepositorInsertHuman Brachyury knockin homology arms (TBXT Human)
Tags2A-EGFPAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
KCNJ6_pCSdest
Plasmid#53804DepositorAvailable SinceMarch 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits