We narrowed to 8,587 results for: AMPH
-
Plasmid#172731PurposeEncodes Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1 Spacer
Plasmid#172729PurposeEncodes Part 1 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1b Spacer
Plasmid#172728PurposeEncodes Part 1b of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 1a Spacer
Plasmid#172727PurposeEncodes Part 1a of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CCLMPC_CAT
Plasmid#237500PurposeDual promoter lentiviral expression control vectorDepositorInsertChloramphenicol acetyl transferase fusion protein
UseLentiviralExpressionMammalianPromoterMND/PGKAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTL
Plasmid#203176PurposeCentromeric yeast expression vector, leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAP1
Plasmid#63674PurposeAccepts DNA sequences via BpiI cloning sites, resulting in Level 0 standard parts for Golden Gate cloning. Parts can be released with a user-defined 4-base-pair, 5 prime overhangs using BsaI.DepositorInsertRFP cloning selection cassette
UseSynthetic BiologyAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS1246
Plasmid#29127PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1245
Plasmid#29126PurposeExpression of the eGFP reporter gene was not detected in the brain using eGFP. Untested in the eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1243
Plasmid#29125PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1492
Plasmid#29240PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle21 (CARTPT Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
His-ZZ-TEV-SNAPf DHC1_IC2C_LIC2_Tctex1_Robl1_LC8
Plasmid#111903PurposeFull length human cytoplasmic dynein 1 complex, optimised for Sf9 expression. 8xHis-ZZ tag followed by TEV cleavage site and SNAPf tag on the N-terminus of dynein heavy chain 1.DepositorInsertsTags8xHis, SNAPf-tag, TEV site, and ZZ-tagExpressionInsectMutationOptimised for expression in Sf9 cells.Available SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_hsHAUScomplex_FL
Plasmid#202203PurposeBaculoviral transfer vector to co-express 8 subunits of human augmin complexDepositorInsertsHAUS1 (HAUS1 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS3 (HAUS3 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS2 (HAUS2 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS6 (HAUS6 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS7 (HAUS7 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS4 (HAUS4 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS5 (HAUS5 Human, codon-optimized form for expression in Trichoplusia ni cells)
HAUS8 (HAUS8 Human, codon-optimized form for expression in Trichoplusia ni cells)
Tags-mGFP-TEV-TwinStrep and His-tag (6x)ExpressionInsectPromoterpolyhedrin promoterAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
MK01
Bacterial Strain#195090PurposeImproved E. coli strain created by knocking out the endogenous lacI gene with chloramphenicol acetyltransferase (cat) selection cassette in the parent strain BW27783 that overcome the all-or-none response of araBAD promoter (PBAD).DepositorBacterial ResistanceChloramphenicolAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EcNR2 Strain
Bacterial Strain#26931DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceJan. 28, 2011AvailabilityAcademic Institutions and Nonprofits only