We narrowed to 21 results for: AMPH
-
TypeBlog Post...General protein expression BL21 (DE3) pLysS* Chloramphenicol (pLysS) pLysS expresses T7 lysozyme to reduce...Expression of toxic proteins BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression...Expression of insoluble proteins Rosetta2 (DE3)* Chloramphenicol (pRARE) Good for “universal” translation; contains...Expression of eukaryotic proteins Lemo21 (DE3)* Chloramphenicol (pLemo) Rhamnose-tunable T7 RNAP expression...T7 expression. The pLys plasmid contains a chloramphenicol resistance cassette for positive selection ...
-
Viral Vectors 101: Gamma-Retroviral Packaging Systems
TypeBlog Post...infection of mouse and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells... -
Harnessing Bacterial Toxins for Allelic Exchange
TypeBlog Post...exchange vector. This vector contains sacB, an chloramphenicol resistance cassette, and the R6K origin of ...products. To allow manipulation of naturally chloramphenicol-resistant strains, we have also included versions... -
Five Popular Model Organisms, Part 2
TypeBlog Post..., or frogs, are one of the most popular model amphibians in science with early research providing insight... Jiang, J. P. (2016). Research proceedings on amphibian model organisms. Dong wu xue yan jiu = Zoological... -
Plasmids 101: Antibiotic Resistance Genes
TypeBlog Post...elongation step) Bacteriostatic 10 ug/mL Chloramphenicol Binds 50S ribosomal subunit; inhibits peptidyl... -
Plasmids 101: Origin of Replication
TypeBlog Post...amplifying more copies with the addition of chloramphenicol – make sure your growth conditions aren't working... -
Working with Nuclear Receptors
TypeBlog Post...reporter gene has over the years evolved from chloramphenicol acetyltransferase to luciferase, the basic ... -
Quickest Way to Deposit Plasmids: The Deposit Spreadsheet
TypeBlog Post... apramycin, blasticidin, bleocin (zeocin), chloramphenicol, erythromicin, gentamicin, hygromycin, kanamycin... -
Popular Retroviral Vectors and Their Uses in Scientific Research
TypeBlog Post...genes via infection with a single ecotropic or amphotropic MuLE lentivirus provides significant genetic ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol Marraffini... -
Plasmids 101: Optimizing Plasmid Yields
TypeBlog Post...e.g. p15A, ColE1) can be increased by adding chloramphenicol to the culture medium. Improve the culture ... -
CRISPR-mediated Plant Base Editors
TypeBlog Post...base editing. They first created a defective chloramphenicol resistance gene (CamR) by introducing a point... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...hsdR17(rK- mK+) XL10 Gold Tetracycline and Chloramphenicol High competency cloning and propagation of ... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post... of two plasmids: pCas9: carries Cas9 and chloramphenicol resistance pCRISPR: carries a spacer targeting... -
CRISPR Plasmids - Bacteria
TypeCollection...Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes, cut Marraffini 44251 pgRNA-bacteria BBa_J23119... -
Protocol - How to Inoculate a Bacterial Culture
TypeProtocol...mL Bleocin 5 µg/mL Carbenicillin 100 µg/mL Chloramphenicol 25 µg/mL Coumermycin 25 µg/mL Gentamycin 10... -
Pouring LB Agar Plates
TypeProtocol...5 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Coumermycin... -
Immunology Research Plasmids and Resources
TypeCollection...HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM AREG amphiregulin AR, CRDGF, MGC13647, SDGF ARMET arginine-rich... -
Gamma-Retroviral Vector Guide
TypeGuide...infection of mouse and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells... -
Sequencing Primers
TypeGuide...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...