We narrowed to 3 results for: AMPH
-
TypeGuide...infection of mouse and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells...
-
Sequencing Primers
TypeGuide...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG... -
Molecular Biology Reference
TypeGuide...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin...