We narrowed to 1,460 results for: KO
-
Plasmid#193246PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-sgZfp536#2/Cre
Plasmid#193249PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#1/Cre
Plasmid#193235PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#1/Cre
Plasmid#193227PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v4)-PGK-Puro-BFP
Plasmid#117143PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v4 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v5)-PGK-Puro-BFP
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro p21 K161Q, K163Q
Plasmid#78792PurposeRetroviral expression of p21 K161Q, K163QDepositorInsertP21 (CDKN1A Human)
UseRetroviralExpressionMammalianMutationK161Q, K163Q muationPromoter5'LTRAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX-6MYC p21 90-164
Plasmid#78786PurposeTo overexpress p21 90-164 in Mammalian CellDepositorAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX-6MYC p21 90-139
Plasmid#78785PurposeTo overexpress p21 90-139 in Mammalian CellsDepositorInsertp21 (CDKN1A Human)
Tags6xMYCExpressionMammalianMutationcontains p21 amino acids 89-139PromoterCMV IE94Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX-6MYC p21 1-89
Plasmid#78784PurposeTo overexpress p21 1-89 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro p21 K161R, K163R
Plasmid#78791PurposeRetroviral expression of p21 K161R, K163RDepositorInsertp21 (CDKN1A Human)
UseRetroviralExpressionMammalianMutationK161R, K163R_muationPromoter5'LTRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-EGFP-T2A-Bsd
Plasmid#193198PurposeLentiviral vector expressing EGFP (driven by EFS promoter) and a blasticidin resistance markerDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterEFSAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mTet2 catalytic domain
Plasmid#79554PurposeExpression of catalytic domain of mouse Tet2DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mTet2 catalytic domain HxD
Plasmid#79611PurposeExpression of catalytically inactive mouse Tet2DepositorInsertTet2 (Tet2 Mouse)
UseLentiviralTagsMycMutationMutant Tet2 with H1302Y, D1304A substitutions in …Available SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV TIP60 delta HAT
Plasmid#78793PurposeTo overexpress TIP60 delta HAT in Mammalian CellDepositorInsertTIP60 (KAT5 Human)
Tags3xFLAGExpressionMammalianMutationHAT domain deletion mutationPromoterCMVAvailable SinceJuly 7, 2016AvailabilityAcademic Institutions and Nonprofits only