We narrowed to 16,015 results for: grn
-
Plasmid#138478PurposeExpresses HIV Tat for efficient sgRNA packaging.DepositorInsertTat
UseTagsExpressionMammalianMutationPromoterAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRTagsExpressionPlantMutationPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 PPP2CA g2
Plasmid#170823PurposePiggyBac Cas13d sgRNA plasmid for PPP2CA knockdownDepositorInsertCas13d PPP2CA gRNA2
UsePiggybac transposonTagsExpressionMammalianMutationPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-LAMP1
Plasmid#207787PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of LAMP1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of LAMP1 (LAMP1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgIRF3#5
Plasmid#127642PurposeKnock-out of human IRF3DepositorAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 sgRipk4 v3
Plasmid#158048Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Ripk4. NO Cas9DepositorInsertRipk4 sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-CreERT2 sgAdam10 v3
Plasmid#158047Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Adam10. NO Cas9DepositorInsertAdam10 sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo sgTREX1
Plasmid#127645PurposeKnock-out of human TREX1 with NeoRDepositorAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNUAK1
Plasmid#138692PurposeExpresses a human NUAK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNUAK2
Plasmid#138693PurposeExpresses a human NUAK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC74
Plasmid#62342PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only