We narrowed to 16,610 results for: grna
-
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2515
Plasmid#91083PurposeModule C, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAtU6Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25H
Plasmid#91145PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ARL13B
Plasmid#227276PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of ARL13B for knock-in.DepositorInsertsgRNA Targeting C-terminus of ARL13B (ARL13B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Dlg4-HaloTag KI
Plasmid#139656PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Bsn-GFP KI
Plasmid#139665PurposeEndogenous tagging of Bassoon: C-terminal (amino acid position: F3938)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Gria1-HaloTag KI
Plasmid#139655PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAPRE1
Plasmid#207793PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of MAPRE1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of MAPRE1 (MAPRE1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-pA
Plasmid#192488PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Bsn KI
Plasmid#139664PurposeEndogenous tagging of Bassoon: N-terminal (amino acid position: L7)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:BRD:tNos (GB1172)
Plasmid#75401PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional RepressorDepositorInsertdCas9:BRD
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgROSA26
Plasmid#231562PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human ROSA26 locus (Puromycin selection marker)DepositorInsertsgROSA26
UseCRISPR and LentiviralExpressionMammalianPromoterU6, EF-1aAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-CLTC
Plasmid#227312PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of CLTC for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only