We narrowed to 18,574 results for: She
-
Plasmid#219887PurposeThe base plasmid of TUNEYALI for TF22DepositorInsertContains gRNA targeting TF22 (YALI1_C25288g) and homologous arm matching TF22
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13202
Plasmid#219877PurposeThe base plasmid of TUNEYALI forTF12DepositorInsertContains gRNA targeting TF12 (YALI1_C06870g) and homologous arm matching TF12
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13234
Plasmid#219907PurposeThe base plasmid of TUNEYALI for TF44DepositorInsertContains gRNA targeting TF44 (YALI1_B22561g) and homologous arm matching TF44
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13219
Plasmid#219894PurposeThe base plasmid of TUNEYALI for TF29DepositorInsertContains gRNA targeting TF29 (YALI1_C09133g) and homologous arm matching TF29
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13248
Plasmid#219919PurposeThe base plasmid of TUNEYALI for TF58DepositorInsertContains gRNA targeting TF58 (YALI1_F37742g) and homologous arm matching TF58
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR6K-crRNA-CASTIF
Plasmid#199654PurposeR6K plasmid with a I-F CAST targeting lacZDepositorInsertCAST I-F systems
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR6K-GFP-CASTIB
Plasmid#199655PurposeR6K plasmid with a I-B CAST but no CRISPR arrayDepositorInsertCAST I-B systems
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-tRNAGln-BbsI-sU6-Kan
Plasmid#213016PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (tRNA-Gln and synthetic U6)DepositorInserttRNAGln promoter, sU6 promoter, gRNA scaffolds
PromotertRNAGln promoterAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only