We narrowed to 19,295 results for: cat
-
Plasmid#63894PurposeLuciferase reporter of mouse Nanog 3'UTR with the miR-34 target site mutatedDepositorInsertNanog homeobox (Nanog Mouse)
ExpressionMammalianAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYSD288
Plasmid#253023PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pGAL1 inducible promoter, tENO2 terminator, KanamycinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-CTNNB1-HA
Plasmid#242217PurposeExpression of full-length human β-catenin using piggyBac transpositionDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc RFC[hk-1s + 5]-pLANT/RIL
Plasmid#239200PurposeOvereexpress Sc RFC1 (truncated N-terminus; N-terminal his tag, PKA kinase motif) in E. coliDepositorTagsHis-10 + PKA kinase motif on truncated Sc RFC1ExpressionBacterialMutationN-terminal truncationAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_E2419K_Dual_pegRNA
Plasmid#178110PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-E2419K pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(E12,14K)-mPAGFP
Plasmid#168495PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertE12,14K mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K29,30A)-mVenus
Plasmid#168485PurposeMammalian expression of the K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_1
Plasmid#160779PurposeSuppress DNA2DepositorInsertshDNA2_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 human APC-B,C (1133–1189)
Plasmid#132630Purposeexpresses human APC-B,C (1133–1189) in E. coliDepositorInsertAPC-B,C (1133–1189)
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G20-R0
Plasmid#101807PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA PSPC1 Y523F
Plasmid#124373PurposeExpresses PSPC1 Y523F in mammalian cellsDepositorAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_nmPKA-Cα-mPAGFP
Plasmid#114131PurposeMammalian expression of the G2A mutant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertof the mouse PKA catalytic subunit α C-terminally tagged by monomeric paGFP with G2A mutation (Prkaca Mouse)
ExpressionMammalianAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(SOD1)
Plasmid#109321PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human SOD1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DST-1/1
Plasmid#91288PurposeProtein expression and purification of human SH3 domain construct DST-1/1DepositorInsertDST-1/1 (DST Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only