We narrowed to 10,088 results for: crispr plasmids
-
Plasmid#208425PurposeLentiviral gRNA plasmid targeting human RIPK3 gene, co-expression of BFP tagDepositorInsertRIPK3 (Ripk3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hTNF_2b)-PGKpuro2ABFP-W
Plasmid#208426PurposeLentiviral gRNA plasmid targeting human TNF gene, co-expression of BFP tagDepositorInsertTNF (TNF Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPTPN11_1k)-PGKpuro2ABFP-W
Plasmid#208427PurposeLentiviral gRNA plasmid targeting human PTPN11 gene, co-expression of BFP tagDepositorInsertPTPN11 (PTPN11 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPTPN11_2b)-PGKpuro2ABFP-W
Plasmid#208428PurposeLentiviral gRNA plasmid targeting human PTPN11 gene, co-expression of BFP tagDepositorInsertPTPN11 (PTPN11 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_1k)-PGKpuro2ABFP-W
Plasmid#208412PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_2m)-PGKpuro2ABFP-W
Plasmid#208413PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for HCT116
Plasmid#238249PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-HP1a-repair-template
Plasmid#238248PurposeFor knock-in msfGFP to HP1a locusDepositorInsertHP1a
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_052_HygroR
Plasmid#228937PurposePlasmid for cloning of custom gRNA using EnAsCas12aDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rab11 single guide RNA
Plasmid#229683Purposeguide RNA for Rab11 tagging at the N-terminus in pX459DepositorInsertRab11 guide (RAB11A Human)
UseCRISPRAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K12(1)-U6-sgMap3K12(2)-hSyn1-mCherry
Plasmid#208835PurposeKnockout of Map3K12 (DLK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K13(2)-hSyn1-mCherry
Plasmid#208836PurposeKnockout of Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1297-AAV-EFSNC-dCjCas9-HP1b(79-173)
Plasmid#223142PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1298-AAV-EFSNC-dCjCas9-HP1bNH(111-173)
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only