We narrowed to 16,597 results for: grna
-
Plasmid#209439PurposeSB-transposable plasmid expressing a FLAGGED mutant histone H3.1-K27M with BFPDepositorInsertH3.1-K27M
ExpressionMammalianMutationK27MAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-H3.3-G34R-FLAG-BFP
Plasmid#209440PurposeLentiviral packagable plasmid expressing FLAGGED human histone mutant H3.3-G34R with BFPDepositorInsertH3.3-G34R
ExpressionMammalianMutationG34RAvailable SinceNov. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shSCR-Puro
Plasmid#135689PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded scrambled control shRNA, Puromycin selectionDepositorInsertshScrambled
UseLentiviralAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-GFP-miRE_shRen-Blast
Plasmid#135682PurposeConstitutive expression (EF1a promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shPten.1523
Plasmid#135667PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shPten into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shRen-Blast
Plasmid#135684PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-tdTomato-miRE_shRen-Blast
Plasmid#135686PurposeConstitutive expression (CMV promoter) of tdTomato cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shOGDH #2
Plasmid#242705PurposeshRNA knockdown human OGDH geneDepositorInsertOGDH (OGDH Human)
UseLentiviralAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shOGDH #1
Plasmid#242704PurposeshRNA knockdown human OGDH geneDepositorInsertOGDH (OGDH Human)
UseLentiviralAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-