We narrowed to 22,954 results for: CAN
-
Plasmid#134986PurposeThe plasmid includes a TagBFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertTagBFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Rc/CMV cyclin D2
Plasmid#8958DepositorInsertcyclin D2 (CCND2 Human)
ExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
RS314-H
Plasmid#17541DepositorAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pWKS1583
Plasmid#70188PurposeModular vector for secreted amylase reporter expressionDepositorInsertamyEopt
UseSynthetic BiologyExpressionBacterialPromoterPtetAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH730-staRLuc
Plasmid#38226DepositorInsertRenilla Luciferase
ExpressionYeastPromoterTDH3 (=GPD)Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGEX2TK E7 DLYC
Plasmid#13672DepositorAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRS315Nab3D191stop
Plasmid#110537PurposeExpresses yeast NAB3 using the endogenous promoterDepositorAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX2TK E7 del EDE
Plasmid#13675DepositorAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
AdenoBuilder toolkit
Plasmid Kit#1000000176PurposePlasmids containing modular inserts that span the human adenovirus serotype 5 (HAdV5) genome that can be assembled in a one-tube reaction.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeAdenoviral, Mammalian ExpressionCloning TypeGibsonAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mScarlet-I
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralPromoterEF1 alphaAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β2B Tubulin
Plasmid#170553PurposeEncodes codon-optimized human α1B and β2B tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
sAB-K29
Plasmid#204735Purposesynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitinDepositorInsertsynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitin
Available SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
HsB2AR-mCherry
Plasmid#137785PurposeVisualization of the Beta-2-adrenergic receptorDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
poly H35S SUMO1
Plasmid#221071PurposeExpression of poly H35S SUMO1 protein under T7 promoterDepositorInsertFive repeats of H35S SUMO1 each separated by (GGS)4 (SUMO1 Human)
TagsHis and MBPExpressionBacterialMutationH35SPromotertacAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc CDC4 WT*
Plasmid#16652DepositorInsertCDC4 (FBXW7 Human)
TagsmycExpressionMammalianMutation*Note that this insert is only WT relative to the…Available SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only